ATGACGGATGCCGGAATTGGCATGACGGATGCCGGAATTGGCACATAACAAGTACTGCTCGGTCCTTAAGCTGTATTGCACCATATGACGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG

Food security

Browse our projects and discoveries on the topic

Logo of ELIXIR
News

Advancing a European initiative on biodiversity, food security and pathogens

A strategy co-developed by SIB will guide work across 21 European countries to...
Image showing a tree in a deserted landscape
News

Unlocking the potential of microbes to make plants climate-resilient

SIB is part of a newly launched pan-European project looking at how...
Image showing the speaker of this in silico talk
In silico talk

An inordinate fondness for beetles, or an arms race with plants?

Are you an evolutionary biologist working with genomics data, or simply...
a woman looking at big reproduction of dna chain
News

Bioinformatics, a Swiss pride - 20 years of service to the life sciences and health

an image of a network of red and white dots
News

Decoding the genome of the wheat stem sawfly, a major agricultural pest

picture of a bee on flower
Page

Environmental Bioinformatics

Upcoming related training

Meet our experts

picture of roberte waterhouse
Environmental Bioinformatics
Robert Waterhouse, SIB Hub, Lausanne
Genes and genomes
picture of Maria Anisimova
Applied Computational Genomics Team
Maria Anisimova, Zurich University of Applied Sciences, Wädenswil
Genes and genomes
A picture of Laurent Falquet, Group Leader at SIB
BUGFri
Laurent Falquet, University of Fribourg, Fribourg
Genes and genomes
Picture of Christophe Dessimoz and Natasha Glover
Comparative Genomics
Christophe Dessimoz, University of Lausanne, Lausanne
Natasha Glover, University of Lausanne, Lausanne
Evolution and phylogeny
picture of Gaston Gonnet
Computational Biochemistry Research
Gaston Gonnet, ETH Zurich, Zurich
Evolution and phylogeny
Avatar
Computational Evolutionary Genomics
Evgeny Zdobnov, University of Geneva, Geneva
Evgenia Kriventseva, University of Geneva, Geneva
Genes and genomes
picture of Carlos-Andrés Peña-Reyes
Computational Intelligence for Computational Biology
Carlos Peña-Reyes, HEIG-VD, Yverdon-les-Bains
Machine learning and text mining
Search