We turn life science data into solutions

Are you a life scientist, a clinician, a biotech or biomedical start-up, SME or pharma? You are at the right place: the SIB Swiss Institute of Bioinformatics is an internationally recognized non-profit organization dedicated to biological and biomedical data science.

ATGACGGATGCCGGAATTGGCATGACGGATGCCGGAATTGGCACATAACAAGTACTGCTCGGTCCTTAAGCTGTATTGCACCATATGACGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ATGACGGATGCCGGAATTGGCATGACGGATGCCGGAATTGGCACATAACAAGTACTGCTCGGTCCTTAAGCTGTATTGCACCATATGACGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG

Latest news and scientific talks

See all news
Image of phylogentic trees used to create the PAN-GO human gene function resource
News

SIB helps create most complete, accurate resource for human gene functions

For the first time, biodata from humans have been integrated with that of other organisms to provide the most comprehensive picture of human gene function to date. The new ‘PAN-GO’ resource used evolutionary modelling co-developed by SIB...
3D computer-generated image of Streptococcus pneumoniae bacteria based on scanning electron microscopic imagery. Credit: Unsplash.
News

Antibiotic-resistant bacteria do not inevitably take over

A comprehensive, long-term analysis of antibiotic resistance in bacteria shows that for many species, the proportion of resistant and non-resistant strains tends to reach an equilibrium over time – and that antibiotic use does not fully...
a diagram showing the process of a person working on a computer.
News

The Swiss Personalized Health Network moves from set-up to sustainable infrastructure

The Swiss Personalized Health Network (SPHN) facilitates the secure use and exchange of health data for research in Switzerland. With the implementation phase successfully completed at the end of 2024, the focus for the next four years is...
Gray and white deer on green grass during daytime
News

Transforming biodiversity data into conservation insights and actions

New tools co-developed by SIB will enable near real-time monitoring of European biodiversity and user-friendly assessments of habitats and species at a scale not previously possible. These innovative outputs of the Biodiversity Meets Data...
News
SIB helps create most complete, accurate resource for human gene functions
News
Antibiotic-resistant bacteria do not inevitably take over
News
The Swiss Personalized Health Network moves from set-up to sustainable infrastructure
News
Transforming biodiversity data into conservation insights and actions
See all news
Register for the BC2 conference

[BC]² Basel Computational Biology Conference - Registration is open!

Register for the [BC]² conference, 8-10 Sept 2025, and benefit from early bird fee until 30 June! 
Deadline: 31 August 2025
banner for the remarkable outputs

Apply to the SIB Remarkable Outputs 2024

Are you an SIB Member or employee with outstanding work to share? We are accepting applications until 7 April 2025.

Creating positive impact for science and society

Our data scientists serve biology, health, environment: find out about our flagship projects and commitments.
businessman using laptop with AI virtual graphic
Focus areas

Generative AI

Generative AI combined with bioinformatics: a wide range of applications
Colourful image with animals and plants interconnected by a DNA strand
Focus areas

One Health

Multiple data challenges
A network of points that connect altogether.
Focus areas

Open research data

Concrete actions to accelerate discoveries and scientific research
Fusion...
Flagship project

Connecting researchers to health data

BioMedIT: the national secure IT network for the responsible processing of health-related data.
Papillon
Focus areas

Biodiversity

What can genes and genome tell us about protecting species
People on a bus wearing masks
Flagship project

Advancing pathogen monitoring: the Swiss Pathogen Surveillance Platform (SPSP)

The platform improves international coordination and research efficiency
Blue image
Focus areas

Artificial intelligence and machine learning

Take stock of our experts’ advances in the field of artificial intelligence

Other flagship projects

Flagship project
European public-private partnerships

SIB acts as an expert in research data management internationally
Flagship project
Oncobench®

Analyzing genomic data from cancer patients

Other themes

Focus areas
Open research data

Concrete actions to accelerate discoveries and scientific research
Focus areas
Personalized health

Making sense of health data to guide treatment decisions
Simone de Montmollin

Over the past 25 years, the institute has established itself as the Swiss reference for biological and biomedical data science.

Simone de Montmollin

National Councillor, President of the Science, Education and Culture Committee SECC

Felix Gutzwiller

Switzerland is well positioned, 
thanks to infrastructure like that of SIB.

Felix Gutzwiller

Former member of the Council of States and National Council

Members of the Scientific Advisory Board of the SIB Swiss Institute of Bioinformatics: Søren Brunak, Christine Orengo, Alexey Nesvizhskii, Ron Shamir, Alfonso Valencia, Claudine Médigue

At a time of revolutionary advances in biology and biomedicine, both in scientific research and its applications, with direct implications for society and the economy, the role of SIB is even more important and central than ever.

Scientific Advisory Board

SAB review, January 2022

Willing to contribute to our national network ?

We are the largest national community of bioinformaticians in Europe

With 200 employees and 700 members, SIB is bringing a wealth of expertise to researchers in the industry, the academia and the clinical realm.

SIB links in Swiss Map

Sharing innovative practices and collaborating on common projects at the forefront of technology and science.

Our projects and resources tackle important societal challenges, from health to the environment.

Our members benefit from unique collaboration and promotion initiatives nationally and internationally.

What is bioinformatics ?

Life scientists and clinicians have always tried to assemble data and evidence to find the right answers to fundamental questions. Nowadays, there is no shortage of data. But a different kind of problem has emerged. New technologies are producing data at an unprecedented speed. Indeed, so much data – and of such variety – that they can no longer be interpreted by the human mind alone.