We turn life science data into progress

By unlocking the full value of data, the SIB Swiss Institute of Bioinformatics delivers positive impact for society as the national organization for biomedical and biological data in Switzerland.

ATGACGGATGCCGGAATTGGCATGACGGATGCCGGAATTGGCACATAACAAGTACTGCTCGGTCCTTAAGCTGTATTGCACCATATGACGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ATGACGGATGCCGGAATTGGCATGACGGATGCCGGAATTGGCACATAACAAGTACTGCTCGGTCCTTAAGCTGTATTGCACCATATGACGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG

Latest news

Swiss Pathogen Surveillance Platform (SPSP) logo
News

SPSP: a vital pathogen resource for public health and food safety agencies

Representatives from Swiss and EU government agencies discussed how the Swiss Pathogen Surveillance Platform (SPSP) can further support a variety of government initiatives for epidemic preparedness and food safety at the recently held SPSP...
Photo of Jérôme Wojcik, Chairmn of the SIN Board of Directors
Opinion

SIB plays a vital role in the Swiss innovation ecosystem

With the current US science crisis, national research infrastructure like SIB is more important than ever to support Swiss industries – and ensure Switzerland remains a global leader in research, innovation, and competitiveness.
The SIB Remarkable Outputs are a shortlist of must-read or works created by SIB Members each year.
News

Discover the SIB Remarkable Outputs 2024

Eight outstanding data resources, software tools, and peer-reviewed publications from our members have been recognized as SIB Remarkable Outputs – an annual spotlight on the excellence and diversity of bioinformatics achievements in...
UniProt logo
News

UniProt: user benefits up to 39 times higher than operational costs

Academic and private researchers using UniProt, a unique and high-quality knowledgebase for proteins co-developed by SIB, benefit from efficiency gains worth a combined €373-565 million each year. This is an impressive return on investment...
News
SPSP: a vital pathogen resource for public health and food safety agencies
Opinion
SIB plays a vital role in the Swiss innovation ecosystem
News
Discover the SIB Remarkable Outputs 2024
News
UniProt: user benefits up to 39 times higher than operational costs
See all news

In the spotlight

the registration for BC2 is open until 1 September

[BC]² Basel Computational Biology Conference - Registration is open!

Register for the [BC]² conference, 8-10 Sept 2025 by 1 September 2025
Cover of the SIB Profile 2025

Discover the SIB Profile 2025

Accelerating discoveries, supporting innovation, maximizing investments

Delivering positive impact for society

Human and planetary health enabled by data science
businessman using laptop with AI virtual graphic
Focus areas

Generative AI

Generative AI combined with bioinformatics: a wide range of applications
Colourful image with animals and plants interconnected by a DNA strand
Focus areas

One Health

Multiple data challenges
A network of points that connect altogether.
Focus areas

Open research data

Concrete actions to accelerate discoveries and scientific research
Fusion...
Flagship project

Connecting researchers to health data

BioMedIT: the national secure IT network for the responsible processing of health-related data.
Papillon
Focus areas

Biodiversity

What can genes and genome tell us about protecting species
People on a bus wearing masks
Flagship project

Advancing pathogen monitoring: the Swiss Pathogen Surveillance Platform (SPSP)

The platform improves international coordination and research efficiency
Blue image
Focus areas

Artificial intelligence and machine learning

Take stock of our experts’ advances in the field of artificial intelligence

Other flagship projects

Flagship project
European public-private partnerships

SIB acts as an expert in research data management internationally
Flagship project
OncoBench®

Analyzing genomic data from cancer patients

Other themes

Focus areas
Open research data

Concrete actions to accelerate discoveries and scientific research
Focus areas
Personalized health

Making sense of health data to guide treatment decisions
Simone de Montmollin

SIB has established itself as the Swiss reference for biological and biomedical data science.

Simone de Montmollin

Swiss National Councillor, President of the Science, Education and Culture Committee SECC

Picture of Jérôme Wojcik

SIB plays a vital role in the Swiss innovation ecosystem by maximizing investments.

Jérôme Wojcik

Industrial Data Scientist & Entrepreneur

Picture of Anita Rauch

Being able to rely on a dedicated organization like SIB is a strong asset for our data-driven projects.

Anita Rauch

Director, Institute of Medical Genetics, University of Zurich

The national organization for life science data

Europe’s largest national bioinformatics community

SIB links in Swiss Map

We are a not-for-profit organization that federates and strengthens Swiss bioinformatics.
 

See more

We comprise ~700 members from 28 institutional partners and ~200 employees.
 

Join SIB

We represent Switzerland in international projects and contribute to the country’s reputation for excellence, quality, and stability.
 

See more

What is bioinformatics ?

Bioinformatics transforms raw biological data into meaningful, reusable knowledge for decision makers, clinicians, scientists, and artificial intelligence.