ATGACGGATGCCGGAATTGGCATGACGGATGCCGGAATTGGCACATAACAAGTACTGCTCGGTCCTTAAGCTGTATTGCACCATATGACGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG

Life science discoveries and innovation for a better future

Delivering positive impact for society

We contribute to healthier, more sustainable societies and a stronger Switzerland by providing high-quality data resources, tools, and expertise.

Explore how in three key areas:

human and planetary health
trustworthy AI
Swiss innovation and competitiveness

See impact examples for SIB Resources

Improving human and planetary health

A butterfly representing the environment and the environmental impact of SIB.

Environmental protection

Our scientists empower researchers, conservation practitioners, and policymakers with open, high-quality biodiversity data and software tools for species analyses, large-scale habitat assessments, and more.

Close up of COVID-19 virus

Epidemic preparedness

Resources developed by SIB Groups were central to Switzerland’s – and many other countries’ – responses to COVID-19. We are building on this expertise to support effective preparedness and response for any pathogen of concern.

Field of wheat

Food security

SIB Groups connect biological knowledge and resources for developing new crops and monitoring food pathogens. Our scientists also conduct basic research into pollinators, agricultural pests, and other diverse aspects of food security.

A man laying on a hospital bed with a doctor

Personalized health

We contribute to precision therapies for cancer, diabetes, and other conditions by connecting patient data from multiple sources, and making these accessible to clinicians and researchers through secure, legally compliant infrastructure.

Enabling trustworthy artificial intelligence

Blue image

Trustworthy AI

The first Nobel-winning AI model was trained and verified using open data resources and platforms developed by SIB scientists. In addition to providing such essential AI foundations, we also develop innovative AI tools for research and clinical applications.

Supporting Swiss innovation and competitiveness

Swiss flag with sky background

Swiss competitiveness

Our data expertise and infrastructure help Switzerland transform data into economic and social value. They also enhance the country’s reputation for excellence, quality and stability, which further feeds resilience and prosperity.

Explore all topics and expertise

Cell mechanobiology

Comparative genomics

Data management

Data visualisation

Database curation

Deep sequencing data

DNA microarrays

Drug resistance

Electronic health record

Environmental protection

Epidemic preparedness

Evolutionary biology

Experimental biology

Functional genomics

Gene regulation

Genome reconstruction

High-performance computing

Homology modelling

In silico organogenesis

Interoperability

Knowledge representation

Mass spectrometry

Medicine and health

Molecular dynamics

Open research data

Pathogen Bioinformatics

Personalized health

Population genetics

Protein engineering

Protein interactions

Signaling pathways

Single-cell biology

Software engineering

Structural biology

Swiss competitiveness

Synthetic biology

Systems biology

Transcriptomics

Services

Training

Scientific training

Acquire skills to make the most out of the latest advances in bioinformatics and data science.

Community

Our groups

Find out more about our experts both at the SIB Hub and institutions across Switzerland.

Our support functions

What's on

About

Find out what drives us, our mission, identity and history over the years.