Skip to main content
Home
We data ‘26
  • Open software and databases

    Essential data resources for the life sciences​

    Portfolio
    Selection
    Recognition
    Impact
    Center of excellence

    Expert services to academia, hospitals, and industry. See all services

    Data management
    Data analysis
    Knowledge representation
    Sensitive data sharing
    Coordination

    Initiatives across institutions, disciplines, and borders

    Federating Swiss bioinformatics
    Global data initiatives
    Flagship research infrastructure
    Swiss Personalized Health Network (SPHN)
    Centre for Pathogen Bioinformatics​
    European public-private initiatives
  • Upcoming courses
    Scientific training
    Acquire skills to make the most out of the latest advances in bioinformatics and data science.
    A group of people sitting at desks in a classroom
    Upcoming training courses
    Brown shoes on asphalt next to white painted arrows pointing left, right, and forward, representing different directions or choices.
    Learning paths
    A class full of students representing the trainings provided by the training group.
    Training group
    A laptop representing the e-learning
    E-learning
    a man working at the laptop illustrating training course materials.
    Course materials
    Picture representing two PhD students working together on the laptop. Job career Franziska Gruehl
    PhD Training Network
    Stay tuned

    Be the first to receive announcements of new courses.

    Leave us your email
  • Our national network

    A Swiss-wide, federated bioinformatics community for collaboration and innovation​

    • How to join
    • Focus groups and other initiatives
    Publications

    Peer-reviewed articles and preprints by SIB scientists.

    Our groups
    900 experts at the SIB Hub and in partner institutions across Switzerland​
    People collaborating around a table
    Browse groups
    Find people
    Our support functions
    Awards
    SIB Awards 2025 Banner
    Bioinformatics Awards
    SIB Remarkable Outputs 2022 Banner
    Remarkable Outputs
  • News

    Discoveries, projects, opinions, talks and more​

    Stay informed
    Sign up to our newsletters​
    Impacts
    Contributions to a better future
    A butterfly representing the environment and the environmental impact of SIB.
    Environmental protection
    Close up of COVID-19 virus
    Epidemic preparedness
    A man laying on a hospital bed with a doctor
    Personalized health
    Field of wheat
    Ensuring food security
    Blue image
    Trustworthy AI
    Swiss flag with sky background
    Swiss competitiveness
    Our conferences
    Logo of the ECCB 2026 conference
    31 August - 4 September 2026
    All upcoming events​
  • What is bioinformatics

    At the heart of modern life science, healthcare and environmental protection

    About
    The national organization for biomedical and biological data in Switzerland​
    Illustration with data scientists
    Who we are
    Two bioinformaticians discussing in a lab
    Our impact
    two kids in front of a screen, participating in a game, an outreach activity for the public.
    Activities for the public
    Our organization
    Governance
    SIB Hub
    Funding sources
    History
    Our engagements
    Working at SIB
    Environmental impact
    Equality, Diversity, Inclusion
    Browse the SIB Profile, our activity report
    Cover of the SIB Profile 2025
    Discover
  • Contact
Search
    • English
    • Français
    • Deutsch
    • Italiano
Home
ATGACGGATGCCGGAATTGGCATGACGGATGCCGGAATTGGCACATAACAAGTACTGCTCGGTCCTTAAGCTGTATTGCACCATATGACGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ATGACGGATGCCGGAATTGGCATGACGGATGCCGGAATTGGCACATAACAAGTACTGCTCGGTCCTTAAGCTGTATTGCACCATATGACGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG

Breadcrumb

  1. Home
  2. People search

Sarah Guethe

Photo of Sarah Guethe
Sarah Guethe
SIB Member
RNA Regulatory Networks, Computational Structural Biology, Genome Systems Biology
Unibas, Biozentrum
Basel
Email
Return to people search

Data scientists for life

SIB Swiss Institute of Bioinformatics

Contact us
Careers
  • Activities
    • Open software and databases
    • Centre of excellence
    • Coordination
    • Contact
  • Training
    • Upcoming training courses
    • Learning paths
    • Training group
  • Community
    • Network
    • Awards
    • How to join SIB
    • Publications
    • Our groups
  • What's on
    • News
    • in silico talks

    • Conferences
  • About
    • Who we are
    • Flagship projects
    • Our impact
    • Activities for the public
    • Governance and organization
    • Funding sources
    • Environmental impact
    • Equality, Diversity, Inclusion
    • History
Follow us on social media

© 2025 - SIB Swiss Institute of Bioinformatics

  • Privacy policy
Search
  • English
  • Français
  • Deutsch
  • Italiano
  • We data ‘26

Activities

Open software and databases

Essential data resources for the life sciences​

Portfolio
Selection
Recognition
Impact
Center of excellence

Expert services to academia, hospitals, and industry. See all services

Data management
Data analysis
Knowledge representation
Sensitive data sharing
Coordination

Initiatives across institutions, disciplines, and borders

Federating Swiss bioinformatics
Global data initiatives
Flagship research infrastructure
Swiss Personalized Health Network (SPHN)
Centre for Pathogen Bioinformatics​
European public-private initiatives

Training

Scientific training
Acquire skills to make the most out of the latest advances in bioinformatics and data science.
A group of people sitting at desks in a classroom
Upcoming training courses
Brown shoes on asphalt next to white painted arrows pointing left, right, and forward, representing different directions or choices.
Learning paths
A class full of students representing the trainings provided by the training group.
Training group
A laptop representing the e-learning
E-learning
a man working at the laptop illustrating training course materials.
Course materials
Picture representing two PhD students working together on the laptop. Job career Franziska Gruehl
PhD Training Network
Upcoming courses
Stay tuned

Be the first to receive announcements of new courses.

Leave us your email

Community

Our groups
900 experts at the SIB Hub and in partner institutions across Switzerland​
People collaborating around a table
Browse groups
Find people
Our support functions
Our national network

A Swiss-wide, federated bioinformatics community for collaboration and innovation​

  • How to join
  • Focus groups and other initiatives
Publications

Peer-reviewed articles and preprints by SIB scientists.

Awards
SIB Awards 2025 Banner
Bioinformatics Awards
SIB Remarkable Outputs 2022 Banner
Remarkable Outputs

What's on

Impacts
Contributions to a better future
A butterfly representing the environment and the environmental impact of SIB.
Environmental protection
Close up of COVID-19 virus
Epidemic preparedness
A man laying on a hospital bed with a doctor
Personalized health
Field of wheat
Ensuring food security
Blue image
Trustworthy AI
Swiss flag with sky background
Swiss competitiveness
News

Discoveries, projects, opinions, talks and more​

Stay informed
Sign up to our newsletters​
Our conferences
Logo of the ECCB 2026 conference
31 August - 4 September 2026
All upcoming events​

About

About
The national organization for biomedical and biological data in Switzerland​
Illustration with data scientists
Who we are
Two bioinformaticians discussing in a lab
Our impact
two kids in front of a screen, participating in a game, an outreach activity for the public.
Activities for the public
Our organization
Governance
SIB Hub
Funding sources
History
Our engagements
Working at SIB
Environmental impact
Equality, Diversity, Inclusion
What is bioinformatics

At the heart of modern life science, healthcare and environmental protection

Browse the SIB Profile, our activity report
Cover of the SIB Profile 2025
Discover
  • Contact