Skip to main content
Home
  • Open software and databases

    Discover our world-class, open biodata resources.

    Coordination

    Find out how we bring together key partners and data in large-scale projects.

    Centre for Pathogen Bioinformatics

    At the forefront of pathogen research and surveillance

    Centre of excellence
    The comprehensive bioinformatics services we offer to unleash innovation in the life sciences.
    Biostatistics and bioinformatics analysis
    Data stewardship and management
    Knowledge representation
    Sensitive data sharing
    Software development
    Training
    Let's collaborate

    What life science data challenges can we help you solve?

    Contact us
  • Upcoming courses
    Scientific training
    Acquire skills to make the most out of the latest advances in bioinformatics and data science.
    A group of people sitting at desks in a classroom
    Upcoming training courses
    A laptop representing the e-learning
    E-learning
    a man working at the laptop illustrating training course materials.
    Course materials
    A picture representing a lecturer and a student.
    Who do we train
    Picture representing two PhD students working together on the laptop. Job career Franziska Gruehl
    PhD Training Network
    Empty Classroom With Desks And Chairs. Lines And Dots Forming A Plexus
    Open and FAIR training
    Stay tuned

    Be the first to receive announcements of new courses.

    Leave us your email
  • Network

    We promote bioinformatics through our network across Switzerland, fostering a strong community spirit to enable innovation and collaboration.

    • How to join
    • Focus groups and other initiatives
    Publications

    Peer-reviewed articles and preprints by our scientists.

    Our groups
    Find out more about our experts both at the SIB Hub and institutions across Switzerland.
    People collaborating around a table
    Browse our groups
    Find people
    Our support functions
    Awards
    SIB Awards 2025 Banner
    Bioinformatics Awards
    SIB Remarkable Outputs 2022 Banner
    Remarkable Outputs
  • Latest outputs

    The latest scientific developments, projects and news from our scientists. Discover the in silico talks, a series of webinars by our scientists. 

     

    Browse our in silico talks

    Stay informed
    Receive the latest updates
    Impacts
    Contributions to a better future
    A butterfly representing the environment and the environmental impact of SIB.
    Environmental protection
    Close up of COVID-19 virus
    Epidemic preparedness
    A man laying on a hospital bed with a doctor
    Personalized health
    Field of wheat
    Food security
    Blue image
    Trustworthy AI
    Swiss flag with sky background
    Swiss competitiveness
    Our conferences
    Logo of the ECCB 2026 conference
    31 August - 4 September 2026
    Upcoming events
  • Flagship projects

    National platforms and secure IT networks, diagnostic tools, international projects and more.

    BioMedIT

    The national secure IT network for health-related data.

    Swiss Pathogen Surveillance Platform

    Advancing pathogen monitoring.

    About
    Find out what drives us, our mission, identity and history over the years.
    Illustration with data scientists
    Who we are
    Two bioinformaticians discussing in a lab
    Our impact
    two kids in front of a screen, participating in a game, an outreach activity for the public.
    Activities for the public
    Our organization
    Governance
    SIB Hub
    Funding sources
    Our engagements
    Working at SIB
    Environmental impact
    Equality, Diversity, Inclusion
    Browse the SIB Profile, our activity report
    Cover of the SIB Profile 2025
    Discover
  • Intranet
  • Careers
  • Contact
Search
    • English
    • Français (AT)
    • Deutsch (AT)
    • Italiano (AT)
Home
ATGACGGATGCCGGAATTGGCATGACGGATGCCGGAATTGGCACATAACAAGTACTGCTCGGTCCTTAAGCTGTATTGCACCATATGACGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ATGACGGATGCCGGAATTGGCATGACGGATGCCGGAATTGGCACATAACAAGTACTGCTCGGTCCTTAAGCTGTATTGCACCATATGACGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG

Breadcrumb

  1. Home
  2. People search

Rita Ruppen

Rita Ruppen
SIB Member
Computational Structural Biology, Genome Systems Biology, RNA Regulatory Networks
Biozentrum
Basel
Email
Return to people search

Data scientists for life

SIB Swiss Institute of Bioinformatics

Contact us
  • Services
    • Open software and databases
    • Centre of excellence
    • Coordination
    • Contact
  • Training
    • Upcoming training courses
    • Open and FAIR training
  • Community
    • Network
    • Awards
    • How to join SIB
    • Publications
    • Our groups
  • What's on
    • News
    • in silico talks

    • Conferences
  • About
    • Who we are
    • Flagship projects
    • Our impact
    • Activities for the public
    • Governance and organization
    • Funding sources
    • Environmental impact
    • Equality, Diversity, Inclusion
Follow us on social media

© 2025 - SIB Swiss Institute of Bioinformatics

  • Privacy policy
Search
  • English
  • Français (AT)
  • Deutsch (AT)
  • Italiano (AT)

Services

Centre of excellence
The comprehensive bioinformatics services we offer to unleash innovation in the life sciences.
Biostatistics and bioinformatics analysis
Data stewardship and management
Knowledge representation
Sensitive data sharing
Software development
Training
Open software and databases

Discover our world-class, open biodata resources.

Coordination

Find out how we bring together key partners and data in large-scale projects.

Centre for Pathogen Bioinformatics

At the forefront of pathogen research and surveillance

Let's collaborate

What life science data challenges can we help you solve?

Contact us

Training

Scientific training
Acquire skills to make the most out of the latest advances in bioinformatics and data science.
A group of people sitting at desks in a classroom
Upcoming training courses
A laptop representing the e-learning
E-learning
a man working at the laptop illustrating training course materials.
Course materials
A picture representing a lecturer and a student.
Who do we train
Picture representing two PhD students working together on the laptop. Job career Franziska Gruehl
PhD Training Network
Empty Classroom With Desks And Chairs. Lines And Dots Forming A Plexus
Open and FAIR training
Upcoming courses
Stay tuned

Be the first to receive announcements of new courses.

Leave us your email

Community

Our groups
Find out more about our experts both at the SIB Hub and institutions across Switzerland.
People collaborating around a table
Browse our groups
Find people
Our support functions
Network

We promote bioinformatics through our network across Switzerland, fostering a strong community spirit to enable innovation and collaboration.

  • How to join
  • Focus groups and other initiatives
Publications

Peer-reviewed articles and preprints by our scientists.

Awards
SIB Awards 2025 Banner
Bioinformatics Awards
SIB Remarkable Outputs 2022 Banner
Remarkable Outputs

What's on

Impacts
Contributions to a better future
A butterfly representing the environment and the environmental impact of SIB.
Environmental protection
Close up of COVID-19 virus
Epidemic preparedness
A man laying on a hospital bed with a doctor
Personalized health
Field of wheat
Food security
Blue image
Trustworthy AI
Swiss flag with sky background
Swiss competitiveness
Latest outputs

The latest scientific developments, projects and news from our scientists. Discover the in silico talks, a series of webinars by our scientists. 

 

Browse our in silico talks

Stay informed
Receive the latest updates
Our conferences
Logo of the ECCB 2026 conference
31 August - 4 September 2026
Upcoming events

About

About
Find out what drives us, our mission, identity and history over the years.
Illustration with data scientists
Who we are
Two bioinformaticians discussing in a lab
Our impact
two kids in front of a screen, participating in a game, an outreach activity for the public.
Activities for the public
Our organization
Governance
SIB Hub
Funding sources
Our engagements
Working at SIB
Environmental impact
Equality, Diversity, Inclusion
Flagship projects

National platforms and secure IT networks, diagnostic tools, international projects and more.

BioMedIT

The national secure IT network for health-related data.

Swiss Pathogen Surveillance Platform

Advancing pathogen monitoring.

Browse the SIB Profile, our activity report
Cover of the SIB Profile 2025
Discover
  • Intranet
  • Careers
  • Contact