ATGACGGATGCCGGAATTGGCATGACGGATGCCGGAATTGGCACATAACAAGTACTGCTCGGTCCTTAAGCTGTATTGCACCATATGACGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG

Epidemic preparedness

Resources developed by SIB Groups were central to Switzerland’s – and many other countries’ – responses to COVID-19. We are building on this expertise to support effective preparedness and response for any pathogen of concern.

Browse our projects and discoveries on the topic

v-pipe logo with dna and human illustration
News

The viral genomics pipeline V-pipe under the spotlight

From SARS-CoV-2 monitoring to HIV antiviral drug resistance detection, the SIB...
BC2 conference digital flyer
News

Join the [BC]2 Basel Computational Biology Conference 2021

[BC]2 is Switzerland's main event in the domain of Computational Biology, and...
a vector illustration of corona virus in desktop
News

Outreach resources to understand the biology of the coronavirus

A new workshop for classrooms, and associated resources for the public, offer...
QCMD quality control for molecular diagnostic logo
News

SIB becomes a partner of QCMD for quality assessment programmes

SIB is a new bioinformatics partner of the QCMD (Quality Control for Molecular...
Image showing the speaker of this in silico talk
In silico talk

An improved view of influenza evolution with CoalRe

“Accounting for reassortment events reduces bias in influenza inference”. In...
spike protein vector illustration
News

Swiss players join European effort to fight COVID-19 and future pandemics

Scientists at SIB and the University of Basel, and Chelonia Applied Sciences...
rainbow lines
News

SIB experts and resources in the fight against coronavirus

From where did the new coronavirus (nCoV, see box) arise, and how did it move to...
a man and woman in a lab talking to each other
News

Molecular big data, a new weapon for medicine

Being able to visualize the transmission of a virus in real-time during an...

Upcoming related training

Search