ATGACGGATGCCGGAATTGGCATGACGGATGCCGGAATTGGCACATAACAAGTACTGCTCGGTCCTTAAGCTGTATTGCACCATATGACGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
Peer-reviewed papers and preprints by our members

Scientific publications 2023

Bioinformatics has become essential to convert biological questions into answers. Discover the breadth of our scientists' work and contributions through their publications. 

 

Source: Europe PMC, latest update: 01.07.2023

Discover the SIB Remarkable Outputs 2022

The Remarkable Outputs are selected by the Award Committee to provide the community with the yearly achievements by SIB Scientists that are particularly deserving attention. From new algorithms to detect disease-related genes to exploring the origins of sexual reproduction, discover this shortlist of publications, software tools, databases and outreach projects.

  1. Abler D, Courlet P, Dietz M, Gatta R, Girard P, Munafo A, Wicky A, Jreige M, Guidi M, Latifyan S, De Micheli R, Csajka C, Prior JO, Michielin O, Terranova N, Cuendet MA. Semiautomated Pipeline to Quantify Tumor Evolution From Real-World Positron Emission Tomography/Computed Tomography Imaging. JCO Clin Cancer Inform 2023;7:e2200126
  2. Adelmann JA, Vetter R, Iber D. The impact of cell size on morphogen gradient precision. Development 2023;150(10):dev201702
  3. Adelmann JA, Vetter R, Iber D. Patterning precision under non-linear morphogen decay and molecular noise. Elife 2023;12:e84757
  4. Agirre J, Atanasova M, Bagdonas H, Ballard CB, Baslé A, Beilsten-Edmands J, Borges RJ, Brown DG, Burgos-Mármol JJ, Berrisford JM, Bond PS, Caballero I, Catapano L, Chojnowski G, Cook AG, Cowtan KD, Croll TI, Debreczeni JÉ, Devenish NE, Dodson EJ, Drevon TR, Emsley P, Evans G, Evans PR, Fando M, Foadi J, Fuentes-Montero L, Garman EF, Gerstel M, Gildea RJ, Hatti K, Hekkelman ML, Heuser P, Hoh SW, Hough MA, Jenkins HT, Jiménez E, Joosten RP, Keegan RM, Keep N, Krissinel EB, Kolenko P, Kovalevskiy O, Lamzin VS, Lawson DM, Lebedev AA, Leslie AGW, Lohkamp B, Long F, Malý M, McCoy AJ, McNicholas SJ, Medina A, Millán C, Murray JW, Murshudov GN, Nicholls RA, Noble MEM, Oeffner R, Pannu NS, Parkhurst JM, Pearce N, Pereira J, Perrakis A, Powell HR, Read RJ, Rigden DJ, Rochira W, Sammito M, Sánchez Rodríguez F, Sheldrick GM, Shelley KL, Simkovic F, Simpkin AJ, Skubak P, Sobolev E, Steiner RA, Stevenson K, Tews I, Thomas JMH, Thorn A, Valls JT, Uski V, Usón I, Vagin A, Velankar S, Vollmar M, Walden H, Waterman D, Wilson KS, Winn MD, Winter G, Wojdyr M, Yamashita K. The CCP4 suite: integrative software for macromolecular crystallography. Acta Crystallogr D Struct Biol 2023;79(pt 6):449-461
  5. Akgül G, Pla-Díaz M, Molak M, du Plessis L, Panagiotopoulou H, Doan K, Bogdanowicz W, Dąbrowski P, Oziębłowski M, Grzelak J, Arora N, González-Candelas F, Majander K, Schuenemann VJ. Inferring patterns of recombination and divergence with ancient and modern treponemal genomes 2023
  6. Akhmetova A, Guerrero J, McAdam P, Salvador LCM, Crispell J, Lavery J, Presho E, Kao RR, Biek R, Menzies F, Trimble N, Harwood R, Pepler PT, Oravcova K, Graham J, Skuce R, du Plessis L, Thompson S, Wright L, Byrne AW, Allen AR. Genomic epidemiology of Mycobacterium bovis infection in sympatric badger and cattle populations in Northern Ireland. Microb Genom 2023;9(5)
  7. Albert JS, Carnaval AC, Flantua SGA, Lohmann LG, Ribas CC, Riff D, Carrillo JD, Fan Y, Figueiredo JJP, Guayasamin JM, Hoorn C, de Melo GH, Nascimento N, Quesada CA, Ulloa Ulloa C, Val P, Arieira J, Encalada AC, Nobre CA. Human impacts outpace natural processes in the Amazon. Science 2023;379(6630):eabo5003
  8. Álvarez-Prado ÁF, Maas RR, Soukup K, Klemm F, Kornete M, Krebs FS, Zoete V, Berezowska S, Brouland JP, Hottinger AF, Daniel RT, Hegi ME, Joyce JA. Immunogenomic analysis of human brain metastases reveals diverse immune landscapes across genetically distinct tumors. Cell Rep Med 2023;4(1):100900
  9. Anchisi S, Wolfer A, Bisig B, Missiglia E, Tiab A, Kamel EM, Michielin O, Coukos G, Homicsko K. Deep and lasting response and acquired resistance to BRAFV600E targeting in a low-grade ovarian cancer patient. Cancer Biol Ther 2023;24(1):2193116
  10. Angori S, Banaei-Esfahani A, Mühlbauer K, Bolck HA, Kahraman A, Karakulak T, Poyet C, Feodoroff M, Potdar S, Kallioniemi O, Pietiäinen V, Schraml P, Moch H. Ex Vivo Drug Testing in Patient-derived Papillary Renal Cancer Cells Reveals EGFR and the BCL2 Family as Therapeutic Targets. Eur Urol Focus 2023:S2405-4569(23)00067-6
  11. Antonello P, Pizzagalli DU, Foglierini M, Melgrati S, Radice E, Thelen S, Thelen M. ACKR3 promotes CXCL12/CXCR4-mediated cell-to-cell-induced lymphoma migration through LTB4 production. Front Immunol 2022;13:1067885
  12. Apsley AT, Domico ER, Verbiest MA, Brogan CA, Buck ER, Burich AJ, Cardone KM, Stone WJ, Anisimova M, Vandenbergh DJ. A novel hypervariable variable number tandem repeat in the dopamine transporter gene (SLC6A3). Life Sci Alliance 2023;6(4):e202201677
  13. Aros-Mualin D, Guadagno CR, Silvestro D, Kessler M. Light, rather than circadian rhythm, regulates gas exchange in ferns and lycophytes. Plant Physiol 2023;191(3):1634-1647
  14. Auf der Maur P, Trefny MP, Baumann Z, Vulin M, Correia AL, Diepenbruck M, Kramer N, Volkmann K, Preca BT, Ramos P, Leroy C, Eichlisberger T, Buczak K, Zilli F, Okamoto R, Rad R, Jensen MR, Fritsch C, Zippelius A, Stadler MB, Bentires-Alj M. N-acetylcysteine overcomes NF1 loss-driven resistance to PI3Kα inhibition in breast cancer. Cell Rep Med 2023;4(4):101002
  15. Auwerx C, Sadler MC, Woh T, Reymond A, Kutalik Z, Porcu E. Exploiting the mediating role of the metabolome to unravel transcript-to-phenotype associations. Elife 2023;12:e81097
  16. Avalos D, Rey G, Ribeiro DM, Ramisch A, Dermitzakis ET, Delaneau O. Genetic variation in cis-regulatory domains suggests cell type-specific regulatory mechanisms in immunity. Commun Biol 2023;6(1):335
  17. Azizoğlu A, Loureiro C, Venetz J, Brent R. Autorepression-Based Conditional Gene Expression System in Yeast for Variation-Suppressed Control of Protein Dosage. Curr Protoc 2023;3(1):e647
  18. Barreiro K, Lay AC, Leparc G, Tran VDT, Rosler M, Dayalan L, Burdet F, Ibberson M, Coward RJM, Huber TB, Krämer BK, Delic D, Holthofer H. An in vitro approach to understand contribution of kidney cells to human urinary extracellular vesicles. J Extracell Vesicles 2023;12(2):e12304
  19. Barut GT, Kreuzer M, Bruggmann R, Summerfield A, Talker SC. Single-cell transcriptomics reveals striking heterogeneity and functional organization of dendritic and monocytic cells in the bovine mesenteric lymph node. Front Immunol 2022;13:1099357
  20. Bastide P, Soneson C, Stern DB, Lespinet O, Gallopin M. A Phylogenetic Framework to Simulate Synthetic Interspecies RNA-Seq Data. Mol Biol Evol 2023;40(1):msac269
  21. Batavia AA, Rutishauser D, Sobottka B, Schraml P, Beerenwinkel N, Moch H. Biallelic ELOC-Inactivated Renal Cell Carcinoma: Molecular Features Supporting Classification as a Distinct Entity. Mod Pathol 2023;36(8):100194
  22. Belser C, Poulain J, Labadie K, Gavory F, Alberti A, Guy J, Carradec Q, Cruaud C, Da Silva C, Engelen S, Mielle P, Perdereau A, Samson G, Gas S, Genoscope Technical Team, Voolstra CR, Galand PE, Flores JM, Hume BCC, Perna G, Ziegler M, Ruscheweyh HJ, Boissin E, Romac S, Bourdin G, Iwankow G, Moulin C, Paz García DA, Agostini S, Banaigs B, Boss E, Bowler C, de Vargas C, Douville E, Forcioli D, Furla P, Gilson E, Lombard F, Pesant S, Reynaud S, Sunagawa S, Thomas OP, Troublé R, Thurber RV, Zoccola D, Scarpelli C, Jacoby EK, Oliveira PH, Aury JM, Allemand D, Planes S, Wincker P. Integrative omics framework for characterization of coral reef ecosystems from the Tara Pacific expedition. Sci Data 2023;10(1):326
  23. Bermúdez-Méndez E, Angelino P, van Keulen L, van de Water S, Rockx B, Pijlman GP, Ciuffi A, Kortekaas J, Wichgers Schreur PJ. Transcriptomic Profiling Reveals Intense Host-Pathogen Dispute Compromising Homeostasis during Acute Rift Valley Fever Virus Infection. J Virol 2023;97(6):e0041523
  24. Bertschi NL, Steck O, Luther F, Bazzini C, von Meyenn L, Schärli S, Vallone A, Felser A, Keller I, Friedli O, Freigang S, Begré N, Radonjic-Hoesli S, Lamos C, Gabutti MP, Benzaquen M, Laimer M, Simon D, Nuoffer JM, Schlapbach C. PPAR-γ regulates the effector function of human T helper 9 cells by promoting glycolysis. Nat Commun 2023;14(1):2471
  25. Beyer D, Vaccarin C, Deupi X, Mapanao AK, Cohrs S, Sozzi-Guo F, Grundler PV, van der Meulen NP, Wang J, Tanriver M, Bode JW, Schibli R, Müller C. A tool for nuclear imaging of the SARS-CoV-2 entry receptor: molecular model and preclinical development of ACE2-selective radiopeptides. EJNMMI Res 2023;13(1):32
  26. Bianchini F, Crivelli V, Abernathy ME, Guerra C, Palus M, Muri J, Marcotte H, Piralla A, Pedotti M, De Gasparo R, Simonelli L, Matkovic M, Toscano C, Biggiogero M, Calvaruso V, Svoboda P, Cervantes Rincón T, Fava T, Podešvová L, Shanbhag AA, Celoria A, Sgrignani J, Stefanik M, Hönig V, Pranclova V, Michalcikova T, Prochazka J, Guerrini G, Mehn D, Ciabattini A, Abolhassani H, Jarrossay D, Uguccioni M, Medaglini D, Pan-Hammarström Q, Calzolai L, Fernandez D, Baldanti F, Franzetti-Pellanda A, Garzoni C, Sedlacek R, Ruzek D, Varani L, Cavalli A, Barnes CO, Robbiani DF. Human neutralizing antibodies to cold linear epitopes and subdomain 1 of the SARS-CoV-2 spike glycoprotein. Sci Immunol 2023;8(81):eade0958
  27. Bignon Y, Wigger L, Ansermet C, Weger BD, Lagarrigue S, Centeno G, Durussel F, Götz L, Ibberson M, Pradervand S, Quadroni M, Weger M, Amati F, Gachon F, Firsov D. Multiomics reveals multilevel control of renal and systemic metabolism by the renal tubular circadian clock. J Clin Invest 2023;133(8):e167133
  28. Bise T, Pfefferli C, Bonvin M, Taylor L, Lischer HEL, Bruggmann R, Jaźwińska A. The regeneration-responsive element careg monitors activation of Müller glia after MNU-induced damage of photoreceptors in the zebrafish retina. Front Mol Neurosci 2023;16:1160707
  29. Bloom JD, Beichman AC, Neher RA, Harris K. Evolution of the SARS-CoV-2 Mutational Spectrum. Mol Biol Evol 2023;40(4):msad085
  30. Bloom JD, Neher RA. Fitness effects of mutations to SARS-CoV-2 proteins 2023
  31. Botos MA, Arora P, Chouvardas P, Mercader N. Transcriptomic data meta-analysis reveals common and injury model specific gene expression changes in the regenerating zebrafish heart. Sci Rep 2023;13(1):5418
  32. Brümmer A, Bergmann S. Disentangling genetic effects on transcriptional and post-transcriptional gene regulation through integrating exon and intron expression QTLs 2023
  33. Buchner B, Clement TJ, de Groot DH, Zanghellini J. ecmtool: fast and memory-efficient enumeration of elementary conversion modes. Bioinformatics 2023;39(3):btad095
  34. Camps J, Noël F, Liechti R, Massenet-Regad L, Rigade S, Götz L, Hoffmann C, Amblard E, Saichi M, Ibrahim MM, Pollard J, Medvedovic J, Roider HG, Soumelis V. Meta-Analysis of Human Cancer Single-Cell RNA-Seq Datasets Using the IMMUcan Database. Cancer Res 2023;83(3):363-373
  35. Cano AV, Gitschlag BL, Rozhoňová H, Stoltzfus A, McCandlish DM, Payne JL. Mutation bias and the predictability of evolution. Philos Trans R Soc Lond B Biol Sci 2023;378(1877):20220055
  36. Cao L, Ruiz Buendía GA, Fournier N, Liu Y, Armand F, Hamelin R, Pavlou M, Radtke F. Resistance mechanism to Notch inhibition and combination therapy in human T-cell acute lymphoblastic leukemia. Blood Adv 2023:bloodadvances.2023010380
  37. Carlisle E, Janis CM, Pisani D, Donoghue PCJ, Silvestro D. A timescale for placental mammal diversification based on Bayesian modeling of the fossil record. Curr Biol 2023:S0960-9822(23)00767-4
  38. Castro LJ, Palagi PM, Beard N, Attwood TK, Brazas MD. Bioschemas training profiles: A set of specifications for standardizing training information to facilitate the discovery of training programs and resources. PLoS Comput Biol 2023;19(6):e1011120
  39. Caucheteur D, May Pendlington Z, Roncaglia P, Gobeill J, Mottin L, Matentzoglu N, Agosti D, Osumi-Sutherland D, Parkinson H, Ruch P. COVoc and COVTriage: novel resources to support literature triage. Bioinformatics 2023;39(1):btac800
  40. Caufield JH, Putman T, Schaper K, Unni DR, Hegde H, Callahan TJ, Cappelletti L, Moxon SA, Ravanmehr V, Carbon S, Chan LE, Cortes K, Shefchek KA, Elsarboukh G, Balhoff JP, Fontana T, Matentzoglu N, Bruskiewich RM, Thessen AE, Harris NL, Munoz-Torres MC, Haendel MA, Robinson PN, Joachimiak MP, Mungall CJ, Reese JT. KG-Hub -- Building and Exchanging Biological Knowledge Graphs 2023
  41. Caufield JH, Putman T, Schaper K, Unni DR, Hegde H, Callahan TJ, Cappelletti L, Moxon SAT, Ravanmehr V, Carbon S, Chan LE, Cortes K, Shefchek KA, Elsarboukh G, Balhoff J, Fontana T, Matentzoglu N, Bruskiewich RM, Thessen AE, Harris NL, Munoz-Torres MC, Haendel MA, Robinson PN, Joachimiak MP, Mungall CJ, Reese JT. KG-Hub - Building and Exchanging Biological Knowledge Graphs. Bioinformatics 2023:btad418
  42. Chen C, Stadler T. GenSpectrum Chat: Data Exploration in Public Health Using Large Language Models 2023
  43. Chen C, Taepper A, Engelniederhammer F, Kellerer J, Roemer C, Stadler T. LAPIS is a fast web API for massive open virus sequencing data. BMC Bioinformatics 2023;24(1):232
  44. Chen C, Taepper A, Engelniederhammer F, Kellerer J, Roemer C, Stadler T. LAPIS is a fast web API for massive open virus sequencing databases 2023
  45. Chen X, Portran D, Widmer LA, Stangier MM, Czub MP, Liakopoulos D, Stelling J, Steinmetz MO, Barral Y. The motor domain of the kinesin Kip2 promotes microtubule polymerization at microtubule tips. J Cell Biol 2023;222(7):e202110126
  46. Cheval B, Darrous L, Choi KW, Klimentidis YC, Raichlen DA, Alexander GE, Cullati S, Kutalik Z, Boisgontier MP. Genetic insights into the causal relationship between physical activity and cognitive functioning. Sci Rep 2023;13(1):5310
  47. Claudel C, Loiseau O, Silvestro D, Lev-Yadun S, Antonelli A. Patterns and drivers of heat production in the plant genus Amorphophallus. Plant J 2023
  48. Cobat A, Zhang Q, Covid Human Genetic Effort, Abel L, Casanova JL, Fellay J. Human Genomics of COVID-19 Pneumonia: Contributions of Rare and Common Variants. Annu Rev Biomed Data Sci 2023
  49. Cooper RL, Milinkovitch MC. Transient agonism of the sonic hedgehog pathway triggers a permanent transition of skin appendage fate in the chicken embryo. Sci Adv 2023;9(20):eadg9619
  50. Cooper RL, Santos-Durán G, Milinkovitch MC. Protocol for the rapid intravenous in ovo injection of developing amniote embryos. STAR Protoc 2023;4(2):102324
  51. Corona Ramirez A, Bregnard D, Junier T, Cailleau G, Dorador C, Bindschedler S, Junier P. Assessment of fungal spores and spore-like diversity in environmental samples by targeted lysis. BMC Microbiol 2023;23(1):68
  52. Corval H, Cumer T, Topaloudis A, Roulin A, Goudet J. Where and when local adaptation happens: lessons from the European barn owl (Tyto alba) 2023
  53. Costa J, Hayes C, Lisacek F. Protein glycosylation and glycoinformatics for novel biomarker discovery in neurodegenerative diseases. Ageing Res Rev 2023;89:101991
  54. Coudert E, Gehant S, de Castro E, Pozzato M, Baratin D, Neto T, Sigrist CJA, Redaschi N, Bridge A, UniProt Consortium. Annotation of biologically relevant ligands in UniProtKB using ChEBI. Bioinformatics 2023;39(1):btac793
  55. Courlet P, Abler D, Guidi M, Girard P, Amato F, Vietti Violi N, Dietz M, Guignard N, Wicky A, Latifyan S, De Micheli R, Jreige M, Dromain C, Csajka C, Prior JO, Venkatakrishnan K, Michielin O, Cuendet MA, Terranova N. Modeling tumor size dynamics based on real-world electronic health records and image data in advanced melanoma patients receiving immunotherapy. CPT Pharmacometrics Syst Pharmacol 2023
  56. Couto JP, Vulin M, Jehanno C, Coissieux MM, Hamelin B, Schmidt A, Ivanek R, Sethi A, Bräutigam K, Frei AL, Hager C, Manivannan M, Gómez-Miragaya J, Obradović MM, Varga Z, Koelzer VH, Mertz KD, Bentires-Alj M. Nicotinamide N-methyltransferase sustains a core epigenetic program that promotes metastatic colonization in breast cancer. EMBO J 2023;42(13):e112559
  57. Crocker J, Payne JL, Walczak AM, Wittkopp PJ. Interdisciplinary approaches to predicting evolutionary biology. Philos Trans R Soc Lond B Biol Sci 2023;378(1877):20220042
  58. Crowell HL, Morillo Leonardo SX, Soneson C, Robinson MD. The shaky foundations of simulating single-cell RNA sequencing data. Genome Biol 2023;24(1):62
  59. Cumer T, Machado AP, San-Jose LM, Ducrest A, Simon C, Roulin A, Goudet J. The genomic architecture of a continuous color polymorphism in the European barn owl (Tyto alba) 2023
  60. Dadonaite B, Crawford KHD, Radford CE, Farrell AG, Yu TC, Hannon WW, Zhou P, Andrabi R, Burton DR, Liu L, Ho DD, Chu HY, Neher RA, Bloom JD. A pseudovirus system enables deep mutational scanning of the full SARS-CoV-2 spike. Cell 2023;186(6):1263-1278.e20
  61. Danis D, Jacobsen JOB, Wagner AH, Groza T, Beckwith MA, Rekerle L, Carmody LC, Reese J, Hegde H, Ladewig MS, Seitz B, Munoz-Torres M, Harris NL, Rambla J, Baudis M, Mungall CJ, Haendel MA, Robinson PN. Phenopacket-tools: Building and validating GA4GH Phenopackets. PLoS One 2023;18(5):e0285433
  62. Darrous L, Hemani G, Smith GD, Kutalik Z. PheWAS-based clustering of Mendelian Randomisation instruments reveals distinct mechanism-specific causal effects between obesity and educational attainment 2023
  63. de Groot DH, Tjalma AJ, Bruggeman FJ, van Nimwegen E. Effective bet-hedging through growth rate dependent stability. Proc Natl Acad Sci U S A 2023;120(8):e2211091120
  64. de Souza VBC, Jordan BT, Tseng E, Nelson EA, Hirschi KK, Sheynkman G, Robinson MD. Transformation of alignment files improves performance of variant callers for long-read RNA sequencing data. Genome Biol 2023;24(1):91
  65. Deichmann J, Bachmann S, Burckhardt MA, Pfister M, Szinnai G, Kaltenbach HM. New model of glucose-insulin regulation characterizes effects of physical activity and facilitates personalized treatment evaluation in children and adults with type 1 diabetes. PLoS Comput Biol 2023;19(2):e1010289
  66. Dhrangadhariya A, Hilfiker R, Sattelmayer M, Giacomino K, Caliesch R, Elsig S, Naderi N, Müller H. First Steps Towards a Risk of Bias Corpus of Randomized Controlled Trials. Stud Health Technol Inform 2023;302:586-590
  67. Dietler N, Lupo U, Bitbol AF. Impact of phylogeny on structural contact inference from protein sequence data. J R Soc Interface 2023;20(199):20220707
  68. Dijokaite-Guraliuc A, Das R, Zhou D, Ginn HM, Liu C, Duyvesteyn HME, Huo J, Nutalai R, Supasa P, Selvaraj M, de Silva TI, Plowright M, Newman TAH, Hornsby H, Mentzer AJ, Skelly D, Ritter TG, Temperton N, Klenerman P, Barnes E, Dunachie SJ, OPTIC consortium, Roemer C, Peacock TP, Paterson NG, Williams MA, Hall DR, Fry EE, Mongkolsapaya J, Ren J, Stuart DI, Screaton GR. Rapid escape of new SARS-CoV-2 Omicron variants from BA.2-directed antibody responses. Cell Rep 2023;42(4):112271
  69. Durairaj J, Waterhouse AM, Mets T, Brodiazhenko T, Abdullah M, Studer G, Akdel M, Andreeva A, Bateman A, Tenson T, Tenson T, Hauryliuk V, Schwede T, Pereira J. What is hidden in the darkness? Deep-learning assisted large-scale protein family curation uncovers novel protein families and folds 2023
  70. Duruz J, Sprecher M, Kaldun JC, Al-Soudy AS, Lischer HEL, van Geest G, Nicholson P, Bruggmann R, Sprecher SG. Molecular characterization of cell types in the squid Loligo vulgaris. Elife 2023;12:e80670
  71. Dylus D, Altenhoff A, Majidian S, Sedlazeck FJ, Dessimoz C. Inference of phylogenetic trees directly from raw sequencing reads using Read2Tree. Nat Biotechnol 2023
  72. Edelson JL, Schneider LD, Amar D, Brink-Kjaer A, Cederberg KL, Kutalik Z, Hagen EW, Peppard PE, Tempaku PF, Tufik S, Evans DS, Stone K, Tranah G, Cade B, Redline S, Haba-Rubio J, Heinzer R, Marques-Vidal P, Vollenweider P, Winkelmann J, Zou J, Mignot E. The genetic etiology of periodic limb movement in sleep. Sleep 2023;46(4):zsac121
  73. Farina B, Godoy P, Benson R, Langer M, Ferreira G. Turtle body size evolution is determined by lineage‐specific specializations rather than global trends Ecol Evol 2023;13(6)
  74. Farina BM, Godoy PL, Benson RBJ, Langer MC, Ferreira GS. Turtle body size evolution is determined by lineage-specific specializations rather than global trends. Ecol Evol 2023;13(6):e10201
  75. Fava M, Stahl SM, De Martin S, Mattarei A, Bettini E, Comai S, Alimonti A, Bifari F, Pani L, Folli F, Guidetti C, Furlan A, Sgrignani J, Locatelli P, Cavalli A, O'Gorman C, Traversa S, Inturrisi CE, Pappagallo M, Manfredi PL. Esmethadone-HCl (REL-1017): a promising rapid antidepressant. Eur Arch Psychiatry Clin Neurosci 2023
  76. Featherstone LA, Duchene S, Vaughan TG. Decoding the Fundamental Drivers of Phylodynamic Inference. Mol Biol Evol 2023;40(6):msad132
  77. Ferdowsi S, Knafou J, Borissov N, Vicente Alvarez D, Mishra R, Amini P, Teodoro D. Deep learning-based risk prediction for interventional clinical trials based on protocol design: A retrospective study. Patterns (N Y) 2023;4(3):100689
  78. Forny P, Bonilla X, Lamparter D, Shao W, Plessl T, Frei C, Bingisser A, Goetze S, van Drogen A, Harshman K, Pedrioli PGA, Howald C, Poms M, Traversi F, Bürer C, Cherkaoui S, Morscher RJ, Simmons L, Forny M, Xenarios I, Aebersold R, Zamboni N, Rätsch G, Dermitzakis ET, Wollscheid B, Baumgartner MR, Froese DS. Integrated multi-omics reveals anaplerotic rewiring in methylmalonyl-CoA mutase deficiency. Nat Metab 2023;5(1):80-95
  79. Foster WJ, Allen BJ, Kitzmann NH, Münchmeyer J, Rettelbach T, Witts JD, Whittle RJ, Larina E, Clapham ME, Dunhill AM. How predictable are mass extinction events? R Soc Open Sci 2023;10(3):221507
  80. Frachon L, Arrigo L, Rusman Q, Poveda L, Qi W, Scopece G, Schiestl FP. Putative Signals of Generalist Plant Species Adaptation to Local Pollinator Communities and Abiotic Factors. Mol Biol Evol 2023;40(3):msad036
  81. Frey K, Rohrer L, Potapenko A, Goetze S, von Eckardstein A, Wollscheid B. Mapping the dynamic cell surface interactome of high-density lipoprotein reveals Aminopeptidase N as modulator of its endothelial uptake 2023
  82. Fritah H, Graciotti M, Lai-Lai Chiang C, Huguenin-Bergenat AL, Petremand R, Ahmed R, Guillaume P, Schmidt J, Stevenson BJ, Gfeller D, Harari A, Kandalaft LE. Cancer vaccines based on whole-tumor lysate or neoepitopes with validated HLA binding outperform those with predicted HLA-binding affinity. iScience 2023;26(4):106288
  83. Fullam A, Letunic I, Schmidt TSB, Ducarmon QR, Karcher N, Khedkar S, Kuhn M, Larralde M, Maistrenko OM, Malfertheiner L, Milanese A, Rodrigues JFM, Sanchis-López C, Schudoma C, Szklarczyk D, Sunagawa S, Zeller G, Huerta-Cepas J, von Mering C, Bork P, Mende DR. proGenomes3: approaching one million accurately and consistently annotated high-quality prokaryotic genomes. Nucleic Acids Res 2023;51(d1):D760-D766
  84. Gainza P, Wehrle S, Van Hall-Beauvais A, Marchand A, Scheck A, Harteveld Z, Buckley S, Ni D, Tan S, Sverrisson F, Goverde C, Turelli P, Raclot C, Teslenko A, Pacesa M, Rosset S, Georgeon S, Marsden J, Petruzzella A, Liu K, Xu Z, Chai Y, Han P, Gao GF, Oricchio E, Fierz B, Trono D, Stahlberg H, Bronstein M, Correia BE. De novo design of protein interactions with learned surface fingerprints. Nature 2023;617(7959):176-184
  85. Galand PE, Ruscheweyh HJ, Salazar G, Hochart C, Henry N, Hume BCC, Oliveira PH, Perdereau A, Labadie K, Belser C, Boissin E, Romac S, Poulain J, Bourdin G, Iwankow G, Moulin C, Armstrong EJ, Paz-García DA, Ziegler M, Agostini S, Banaigs B, Boss E, Bowler C, de Vargas C, Douville E, Flores M, Forcioli D, Furla P, Gilson E, Lombard F, Pesant S, Reynaud S, Thomas OP, Troublé R, Zoccola D, Voolstra CR, Thurber RV, Sunagawa S, Wincker P, Allemand D, Planes S. Diversity of the Pacific Ocean coral reef microbiome. Nat Commun 2023;14(1):3039
  86. Gallon J, Rodriguez-Calero A, Benjak A, Akhoundova D, Maletti S, Amstutz U, Hewer E, Genitsch V, Fleischmann A, Rushing EJ, Grobholz R, Fischer I, Jochum W, Cathomas G, Osunkoya AO, Bubendorf L, Moch H, Thalmann G, Feng FY, Gillessen S, Ng CKY, Rubin MA, Piscuoglio S. DNA Methylation Landscapes of Prostate Cancer Brain Metastasis Are Shaped by Early Driver Genetic Alterations. Cancer Res 2023;83(8):1203-1213
  87. Gandarilla-Pérez CA, Pinilla S, Bitbol AF, Weigt M. Combining phylogeny and coevolution improves the inference of interaction partners among paralogous proteins. PLoS Comput Biol 2023;19(3):e1011010
  88. Gehin C, Lone MA, Lee W, Capolupo L, Ho S, Adeyemi AM, Gerkes EH, Stegmann AP, López-Martín E, Bermejo-Sánchez E, Martínez-Delgado B, Zweier C, Kraus C, Popp B, Strehlow V, Gräfe D, Knerr I, Jones ER, Zamuner S, Abriata LA, Kunnathully V, Moeller BE, Vocat A, Rommelaere S, Bocquete JP, Ruchti E, Limoni G, Van Campenhoudt M, Bourgeat S, Henklein P, Gilissen C, van Bon BW, Pfundt R, Willemsen MH, Schieving JH, Leonardi E, Soli F, Murgia A, Guo H, Zhang Q, Xia K, Fagerberg CR, Beier CP, Larsen MJ, Valenzuela I, Fernández-Álvarez P, Xiong S, Śmigiel R, López-González V, Armengol L, Morleo M, Selicorni A, Torella A, Blyth M, Cooper NS, Wilson V, Oegema R, Herenger Y, Garde A, Bruel AL, Tran Mau-Them F, Maddocks AB, Bain JM, Bhat MA, Costain G, Kannu P, Marwaha A, Champaigne NL, Friez MJ, Richardson EB, Gowda VK, Srinivasan VM, Gupta Y, Lim TY, Sanna-Cherchi S, Lemaitre B, Yamaji T, Hanada K, Burke JE, Jakšić AM, McCabe BD, De Los Rios P, Hornemann T, D'Angelo G, Gennarino VA. CERT1 mutations perturb human development by disrupting sphingolipid homeostasis. J Clin Invest 2023;133(10):e165019
  89. Gendre M, Hauffe T, Pimiento C, Silvestro D. Benchmarking imputation methods for discrete biological data 2023
  90. Gfeller D, Liu Y, Racle J. Contemplating immunopeptidomes to better predict them. Semin Immunol 2023;66:101708
  91. Gfeller D, Schmidt J, Croce G, Guillaume P, Bobisse S, Genolet R, Queiroz L, Cesbron J, Racle J, Harari A. Improved predictions of antigen presentation and TCR recognition with MixMHCpred2.2 and PRIME2.0 reveal potent SARS-CoV-2 CD8+ T-cell epitopes. Cell Syst 2023;14(1):72-83.e5
  92. Ghenu AH, Amado A, Gordo I, Bank C. Epistasis decreases with increasing antibiotic pressure but not temperature. Philos Trans R Soc Lond B Biol Sci 2023;378(1877):20220058
  93. Giannuzzi G, Chatron N, Mannik K, Auwerx C, Pradervand S, Willemin G, Hoekzema K, Nuttle X, Chrast J, Sadler MC, Porcu E, 16p11.2 Consortium, Herault Y, Isidor B, Gilbert-Dussardier B, Eichler EE, Kutalik Z, Reymond A. Author Correction: Possible association of 16p11.2 copy number variation with altered lymphocyte and neutrophil counts. NPJ Genom Med 2023;8(1):9
  94. Gilholm P, Gibbons K, Brüningk S, Klatt J, Vaithianathan R, Long D, Millar J, Tomaszewski W, Schlapbach LJ, Australian and New Zealand Intensive Care Society (ANZICS) Centre for Outcomes & Resource Evaluation (CORE) and ANZICS Paediatric Study Group (ANZICS PSG). Machine learning to predict poor school performance in paediatric survivors of intensive care: a population-based cohort study. Intensive Care Med 2023
  95. Gitschlag BL, Cano AV, Payne JL, McCandlish DM, Stoltzfus A. Mutation and selection induce correlations between selection coefficients and mutation rates 2023
  96. Gollub MG, Backes T, Kaltenbach H, Stelling J. ENKIE: A package for predicting enzyme kinetic parameter values and their uncertainties 2023
  97. Gómez HF, Doumpas N, Iber D. Time-lapse and cleared imaging of mouse embryonic lung explants to study three-dimensional cell morphology and topology dynamics. STAR Protoc 2023;4(2):102187
  98. Goverde CA, Wolf B, Khakzad H, Rosset S, Correia BE. De novo protein design by inversion of the AlphaFold structure prediction network. Protein Sci 2023;32(6):e4653
  99. Graf C, Fuhrmann L, Lutz T, Stephan C, Knecht G, Gute P, Bickel M, Peiffer KH, Finkelmeier F, Dultz G, Mondorf A, Wetzstein N, Filmann N, Herrmann E, Zeuzem S, Beerenwinkel N, Dietz J, Sarrazin C. Expanding epidemic of recently acquired HCV in HIV-coinfected patients over a period of 10 years. JHEP Rep 2023;5(7):100701
  100. Graham SE, Clarke SL, Wu KH, Kanoni S, Zajac GJM, Ramdas S, Surakka I, Ntalla I, Vedantam S, Winkler TW, Locke AE, Marouli E, Hwang MY, Han S, Narita A, Choudhury A, Bentley AR, Ekoru K, Verma A, Trivedi B, Martin HC, Hunt KA, Hui Q, Klarin D, Zhu X, Thorleifsson G, Helgadottir A, Gudbjartsson DF, Holm H, Olafsson I, Akiyama M, Sakaue S, Terao C, Kanai M, Zhou W, Brumpton BM, Rasheed H, Ruotsalainen SE, Havulinna AS, Veturi Y, Feng Q, Rosenthal EA, Lingren T, Pacheco JA, Pendergrass SA, Haessler J, Giulianini F, Bradford Y, Miller JE, Campbell A, Lin K, Millwood IY, Hindy G, Rasheed A, Faul JD, Zhao W, Weir DR, Turman C, Huang H, Graff M, Mahajan A, Brown MR, Zhang W, Yu K, Schmidt EM, Pandit A, Gustafsson S, Yin X, Luan J, Zhao JH, Matsuda F, Jang HM, Yoon K, Medina-Gomez C, Pitsillides A, Hottenga JJ, Willemsen G, Wood AR, Ji Y, Gao Z, Haworth S, Mitchell RE, Chai JF, Aadahl M, Yao J, Manichaikul A, Warren HR, Ramirez J, Bork-Jensen J, Kårhus LL, Goel A, Sabater-Lleal M, Noordam R, Sidore C, Fiorillo E, McDaid AF, Marques-Vidal P, Wielscher M, Trompet S, Sattar N, Møllehave LT, Thuesen BH, Munz M, Zeng L, Huang J, Yang B, Poveda A, Kurbasic A, Lamina C, Forer L, Scholz M, Galesloot TE, Bradfield JP, Daw EW, Zmuda JM, Mitchell JS, Fuchsberger C, Christensen H, Brody JA, Feitosa MF, Wojczynski MK, Preuss M, Mangino M, Christofidou P, Verweij N, Benjamins JW, Engmann J, Kember RL, Slieker RC, Lo KS, Zilhao NR, Le P, Kleber ME, Delgado GE, Huo S, Ikeda DD, Iha H, Yang J, Liu J, Leonard HL, Marten J, Schmidt B, Arendt M, Smyth LJ, Cañadas-Garre M, Wang C, Nakatochi M, Wong A, Hutri-Kähönen N, Sim X, Xia R, Huerta-Chagoya A, Fernandez-Lopez JC, Lyssenko V, Ahmed M, Jackson AU, Yousri NA, Irvin MR, Oldmeadow C, Kim HN, Ryu S, Timmers PRHJ, Arbeeva L, Dorajoo R, Lange LA, Chai X, Prasad G, Lorés-Motta L, Pauper M, Long J, Li X, Theusch E, Takeuchi F, Spracklen CN, Loukola A, Bollepalli S, Warner SC, Wang YX, Wei WB, Nutile T, Ruggiero D, Sung YJ, Hung YJ, Chen S, Liu F, Yang J, Kentistou KA, Gorski M, Brumat M, Meidtner K, Bielak LF, Smith JA, Hebbar P, Farmaki AE, Hofer E, Lin M, Xue C, Zhang J, Concas MP, Vaccargiu S, van der Most PJ, Pitkänen N, Cade BE, Lee J, van der Laan SW, Chitrala KN, Weiss S, Zimmermann ME, Lee JY, Choi HS, Nethander M, Freitag-Wolf S, Southam L, Rayner NW, Wang CA, Lin SY, Wang JS, Couture C, Lyytikäinen LP, Nikus K, Cuellar-Partida G, Vestergaard H, Hildalgo B, Giannakopoulou O, Cai Q, Obura MO, van Setten J, Li X, Schwander K, Terzikhan N, Shin JH, Jackson RD, Reiner AP, Martin LW, Chen Z, Li L, Highland HM, Young KL, Kawaguchi T, Thiery J, Bis JC, Nadkarni GN, Launer LJ, Li H, Nalls MA, Raitakari OT, Ichihara S, Wild SH, Nelson CP, Campbell H, Jäger S, Nabika T, Al-Mulla F, Niinikoski H, Braund PS, Kolcic I, Kovacs P, Giardoglou T, Katsuya T, Bhatti KF, de Kleijn D, de Borst GJ, Kim EK, Adams HHH, Ikram MA, Zhu X, Asselbergs FW, Kraaijeveld AO, Beulens JWJ, Shu XO, Rallidis LS, Pedersen O, Hansen T, Mitchell P, Hewitt AW, Kähönen M, Pérusse L, Bouchard C, Tönjes A, Chen YI, Pennell CE, Mori TA, Lieb W, Franke A, Ohlsson C, Mellström D, Cho YS, Lee H, Yuan JM, Koh WP, Rhee SY, Woo JT, Heid IM, Stark KJ, Völzke H, Homuth G, Evans MK, Zonderman AB, Polasek O, Pasterkamp G, Hoefer IE, Redline S, Pahkala K, Oldehinkel AJ, Snieder H, Biino G, Schmidt R, Schmidt H, Chen YE, Bandinelli S, Dedoussis G, Thanaraj TA, Kardia SLR, Kato N, Schulze MB, Girotto G, Jung B, Böger CA, Joshi PK, Bennett DA, De Jager PL, Lu X, Mamakou V, Brown M, Caulfield MJ, Munroe PB, Guo X, Ciullo M, Jonas JB, Samani NJ, Kaprio J, Pajukanta P, Adair LS, Bechayda SA, de Silva HJ, Wickremasinghe AR, Krauss RM, Wu JY, Zheng W, den Hollander AI, Bharadwaj D, Correa A, Wilson JG, Lind L, Heng CK, Nelson AE, Golightly YM, Wilson JF, Penninx B, Kim HL, Attia J, Scott RJ, Rao DC, Arnett DK, Hunt SC, Walker M, Koistinen HA, Chandak GR, Yajnik CS, Mercader JM, Tusié-Luna T, Aguilar-Salinas CA, Villalpando CG, Orozco L, Fornage M, Tai ES, van Dam RM, Lehtimäki T, Chaturvedi N, Yokota M, Liu J, Reilly DF, McKnight AJ, Kee F, Jöckel KH, McCarthy MI, Palmer CNA, Vitart V, Hayward C, Simonsick E, van Duijn CM, Lu F, Qu J, Hishigaki H, Lin X, März W, Parra EJ, Cruz M, Gudnason V, Tardif JC, Lettre G, 't Hart LM, Elders PJM, Damrauer SM, Kumari M, Kivimaki M, van der Harst P, Spector TD, Loos RJF, Province MA, Psaty BM, Brandslund I, Pramstaller PP, Christensen K, Ripatti S, Widén E, Hakonarson H, Grant SFA, Kiemeney LALM, de Graaf J, Loeffler M, Kronenberg F, Gu D, Erdmann J, Schunkert H, Franks PW, Linneberg A, Jukema JW, Khera AV, Männikkö M, Jarvelin MR, Kutalik Z, Cucca F, Mook-Kanamori DO, van Dijk KW, Watkins H, Strachan DP, Grarup N, Sever P, Poulter N, Rotter JI, Dantoft TM, Karpe F, Neville MJ, Timpson NJ, Cheng CY, Wong TY, Khor CC, Sabanayagam C, Peters A, Gieger C, Hattersley AT, Pedersen NL, Magnusson PKE, Boomsma DI, de Geus EJC, Cupples LA, van Meurs JBJ, Ghanbari M, Gordon-Larsen P, Huang W, Kim YJ, Tabara Y, Wareham NJ, Langenberg C, Zeggini E, Kuusisto J, Laakso M, Ingelsson E, Abecasis G, Chambers JC, Kooner JS, de Vries PS, Morrison AC, North KE, Daviglus M, Kraft P, Martin NG, Whitfield JB, Abbas S, Saleheen D, Walters RG, Holmes MV, Black C, Smith BH, Justice AE, Baras A, Buring JE, Ridker PM, Chasman DI, Kooperberg C, Wei WQ, Jarvik GP, Namjou B, Hayes MG, Ritchie MD, Jousilahti P, Salomaa V, Hveem K, Åsvold BO, Kubo M, Kamatani Y, Okada Y, Murakami Y, Thorsteinsdottir U, Stefansson K, Ho YL, Lynch JA, Rader DJ, Tsao PS, Chang KM, Cho K, O'Donnell CJ, Gaziano JM, Wilson P, Rotimi CN, Hazelhurst S, Ramsay M, Trembath RC, van Heel DA, Tamiya G, Yamamoto M, Kim BJ, Mohlke KL, Frayling TM, Hirschhorn JN, Kathiresan S, VA Million Veteran Program, Global Lipids Genetics Consortium, Boehnke M, Natarajan P, Peloso GM, Brown CD, Morris AP, Assimes TL, Deloukas P, Sun YV, Willer CJ. Author Correction: The power of genetic diversity in genome-wide association studies of lipids. Nature 2023;618(7965):E19-E20
  101. Grob L, Bertolini A, Carrara M, Lischetti U, Tastanova A, Beisel C, Levesque MP, Stekhoven DJ, Singer F. gExcite - A start-to-end framework for single-cell gene expression, hashing, and antibody analysis. Bioinformatics 2023:btad329
  102. Grover A, Riaz A, Al Sium S, Dincaslan F, Chowdhury S, Olguin-Orellana G, Parra R, Eranti P. 1st ASCS: Expanding the ISCB Student Council Symposia to Asia [version 1; peer review: not peer reviewed] F1000Res 2023;12
  103. Grover A, Riaz A, Al Sium SM, Dincaslan FB, Chowdhury SF, Olguin-Orellana GJ, Parra RG, Eranti P. 1st ASCS: Expanding the ISCB Student Council Symposia to Asia. F1000Res 2023;12:703
  104. Gruhl T, Weinert T, Rodrigues MJ, Milne CJ, Ortolani G, Nass K, Nango E, Sen S, Johnson PJM, Cirelli C, Furrer A, Mous S, Skopintsev P, James D, Dworkowski F, Båth P, Kekilli D, Ozerov D, Tanaka R, Glover H, Bacellar C, Brünle S, Casadei CM, Diethelm AD, Gashi D, Gotthard G, Guixà-González R, Joti Y, Kabanova V, Knopp G, Lesca E, Ma P, Martiel I, Mühle J, Owada S, Pamula F, Sarabi D, Tejero O, Tsai CJ, Varma N, Wach A, Boutet S, Tono K, Nogly P, Deupi X, Iwata S, Neutze R, Standfuss J, Schertler G, Panneels V. Ultrafast structural changes direct the first molecular events of vision. Nature 2023;615(7954):939-944
  105. Guidetti F, Arribas AJ, Sartori G, Spriano F, Barnabei L, Tarantelli C, Von Roemeling R, Martinez E, Zucca E, Bertoni F. Targeting IRAK4 with Emavusertib in Lymphoma Models with Secondary Resistance to PI3K and BTK Inhibitors. J Clin Med 2023;12(2):399
  106. Guinat C, Tang H, Yang Q, Valenzuela Agüí C, Vaughan TG, Scire J, Yu H, Wang W, Chen Z, Ducatez MF, Stadler T. Bayesian phylodynamics reveals the transmission dynamics of avian influenza A(H7N9) virus at the human-live bird market interface in China. Proc Natl Acad Sci U S A 2023;120(17):e2215610120
  107. Hadjeras L, Heiniger B, Maaß S, Scheuer R, Gelhausen R, Azarderakhsh S, Barth-Weber S, Backofen R, Becher D, Ahrens CH, Sharma CM, Evguenieva-Hackenberg E. Unraveling the small proteome of the plant symbiont Sinorhizobium meliloti by ribosome profiling and proteogenomics. Microlife 2023;4:uqad012
  108. Hansen SB, Bozzi D, Mak SST, Clausen CG, Nielsen TK, Kodama M, Hansen LH, Gilbert MTP, Limborg MT. Intestinal epigenotype of Atlantic salmon (Salmo salar) associates with tenacibaculosis and gut microbiota composition. Genomics 2023;115(3):110629
  109. Hatos A, Teixeira JM, Barrera-Vilarmau S, Horvath A, Tosatto SCE, Vendruscolo M, Fuxreiter M. FuzPred: a web server for the sequence-based prediction of the context-dependent binding modes of proteins. Nucleic Acids Res 2023:gkad214
  110. Hausmann D, Todorski I, Pindur A, Weiland E, Benkert T, Bosshard L, Prummer M, Kubik-Huch RA. Advanced Diffusion-Weighted Imaging Sequences for Breast MRI: Comprehensive Comparison of Improved Sequences and Ultra-High B-Values to Identify the Optimal Combination. Diagnostics (Basel) 2023;13(4):607
  111. Hernández-Plaza A, Szklarczyk D, Botas J, Cantalapiedra CP, Giner-Lamia J, Mende DR, Kirsch R, Rattei T, Letunic I, Jensen LJ, Bork P, von Mering C, Huerta-Cepas J. eggNOG 6.0: enabling comparative genomics across 12 535 organisms. Nucleic Acids Res 2023;51(d1):D389-D394
  112. Herzig A, Rubinacci S, Marenne G, Perdry H, Dina C, Redon R, Delaneau O, Génin E, FrEx Consortium, FranceGenRef Consortium. SURFBAT: a surrogate family-based association test building on large imputation reference panels 2023
  113. Heßler N, Ziegler A. Content and form of original research articles in general major medical journals. PLoS One 2023;18(6):e0287677
  114. Hiltemann S, Rasche H, Gladman S, Hotz HR, Larivière D, Blankenberg D, Jagtap PD, Wollmann T, Bretaudeau A, Goué N, Griffin TJ, Royaux C, Le Bras Y, Mehta S, Syme A, Coppens F, Droesbeke B, Soranzo N, Bacon W, Psomopoulos F, Gallardo-Alba C, Davis J, Föll MC, Fahrner M, Doyle MA, Serrano-Solano B, Fouilloux AC, van Heusden P, Maier W, Clements D, Heyl F, Galaxy Training Network, Grüning B, Batut B. Galaxy Training: A powerful framework for teaching! PLoS Comput Biol 2023;19(1):e1010752
  115. Hochart C, Paoli L, Ruscheweyh HJ, Salazar G, Boissin E, Romac S, Poulain J, Bourdin G, Iwankow G, Moulin C, Ziegler M, Porro B, Armstrong EJ, Hume BCC, Aury JM, Pogoreutz C, Paz-García DA, Nugues MM, Agostini S, Banaigs B, Boss E, Bowler C, de Vargas C, Douville E, Flores M, Forcioli D, Furla P, Gilson E, Lombard F, Pesant S, Reynaud S, Thomas OP, Troublé R, Wincker P, Zoccola D, Allemand D, Planes S, Thurber RV, Voolstra CR, Sunagawa S, Galand PE. Ecology of Endozoicomonadaceae in three coral genera across the Pacific Ocean. Nat Commun 2023;14(1):3037
  116. Hodel F, Xu ZM, Thorball CW, de La Harpe R, Letang-Mathieu P, Brenner N, Butt J, Bender N, Waterboer T, Marques-Vidal PM, Vollenweider P, Vaucher J, Fellay J. Associations of genetic and infectious risk factors with coronary heart disease. Elife 2023;12:e79742
  117. Huang Q, Baudis M. Candidate targets of copy number deletion events across 17 cancer types. Front Genet 2022;13:1017657
  118. Humbert M, Olofsson A, Wullimann D, Niessl J, Hodcroft EB, Cai C, Gao Y, Sohlberg E, Dyrdak R, Mikaeloff F, Neogi U, Albert J, Malmberg KJ, Lund-Johansen F, Aleman S, Björkhem-Bergman L, Jenmalm MC, Ljunggren HG, Buggert M, Karlsson AC. Functional SARS-CoV-2 cross-reactive CD4+ T cells established in early childhood decline with age. Proc Natl Acad Sci U S A 2023;120(12):e2220320120
  119. Inchanalkar M, Srivatsa S, Ambatipudi S, Bhosale PG, Patil A, Schäffer AA, Beerenwinkel N, Mahimkar MB. Genome-wide DNA methylation profiling of HPV-negative leukoplakia and gingivobuccal complex cancers. Clin Epigenetics 2023;15(1):93
  120. Isbel L, Iskar M, Durdu S, Weiss J, Grand RS, Hietter-Pfeiffer E, Kozicka Z, Michael AK, Burger L, Thomä NH, Schübeler D. Readout of histone methylation by Trim24 locally restricts chromatin opening by p53. Nat Struct Mol Biol 2023
  121. Jauch AJ, Bignucolo O, Seki S, Ghraichy M, Delmonte OM, von Niederhäusern V, Higgins R, Ghosh A, Nishizawa M, Tanaka M, Baldrich A, Köppen J, Hirsiger JR, Hupfer R, Ehl S, Rensing-Ehl A, Hopfer H, Prince SS, Daley SR, Marquardsen FA, Meyer BJ, Tamm M, Daikeler TD, Diesch T, Kühne T, Helbling A, Berkemeier C, Heijnen I, Navarini AA, Trück J, de Villartay JP, Oxenius A, Berger CT, Hess C, Notarangelo LD, Yamamoto H, Recher M. Autoimmunity and immunodeficiency associated with monoallelic LIG4 mutations via haploinsufficiency. J Allergy Clin Immunol 2023:S0091-6749(23)00422-0
  122. Jaume-Santero F, Bornet A, Valery A, Naderi N, Vicente Alvarez D, Proios D, Yazdani A, Bournez C, Fessard T, Teodoro D. Transformer Performance for Chemical Reactions: Analysis of Different Predictive and Evaluation Scenarios. J Chem Inf Model 2023;63(7):1914-1924
  123. Johnson Z, Tarantelli C, Civanelli E, Cascione L, Spriano F, Fraser A, Shah P, Nomanbhoy T, Napoli S, Rinaldi A, Niewola-Staszkowska K, Lahn M, Perrin D, Wenes M, Migliorini D, Bertoni F, van der Veen L, Di Conza G. IOA-244 is a Non-ATP-competitive, Highly Selective, Tolerable PI3K Delta Inhibitor That Targets Solid Tumors and Breaks Immune Tolerance. Cancer Res Commun 2023;3(4):576-591
  124. Jowkar G, Pečerska J, Maiolo M, Gil M, Anisimova M. ARPIP: Ancestral Sequence Reconstruction with Insertions and Deletions under the Poisson Indel Process. Syst Biol 2023;72(2):307-318
  125. Karakulak T, Szklarczyk D, Saylan CC, Moch H, von Mering C, Kahraman A. CanIsoNet: a database to study the functional impact of isoform switching events in diseases. Bioinform Adv 2023;3(1):vbad050
  126. Kashani E, Schnidrig D, Gheinani AH, Ninck MS, Zens P, Maragkou T, Baumgartner U, Schucht P, Rätsch G, Rubin MA, SOCIBP consortium, Berezowska S, Ng CKY, Vassella E. Integrated longitudinal analysis of adult grade 4 diffuse gliomas with long-term relapse interval revealed upregulation of TGF-β signaling in recurrent tumors. Neuro Oncol 2023;25(4):662-673
  127. Katsantoni M, van Nimwegen E, Zavolan M. Improved analysis of (e)CLIP data with RCRUNCH yields a compendium of RNA-binding protein binding sites and motifs. Genome Biol 2023;24(1):77
  128. Kentistou KA, Luan J, Wittemans LBL, Hambly C, Klaric L, Kutalik Z, Speakman JR, Wareham NJ, Kendall TJ, Langenberg C, Wilson JF, Joshi PK, Morton NM. Large scale phenotype imputation and in vivo functional validation implicate ADAMTS14 as an adiposity gene. Nat Commun 2023;14(1):307
  129. Khameneh HJ, Fonta N, Zenobi A, Niogret C, Ventura P, Guerra C, Kwee I, Rinaldi A, Pecoraro M, Geiger R, Cavalli A, Bertoni F, Vivier E, Trumpp A, Guarda G. Myc controls NK cell development, IL-15-driven expansion, and translational machinery. Life Sci Alliance 2023;6(7):e202302069
  130. Kim T, Chen D, Hornauer P, Emmenegger V, Bartram J, Ronchi S, Hierlemann A, Schröter M, Roqueiro D. Predicting in vitro single-neuron firing rates upon pharmacological perturbation using Graph Neural Networks. Front Neuroinform 2022;16:1032538
  131. Klopfenstein SAI, Thun S, Crameri K, Stellmach C. Mapping the SPHN Dataset to FHIR. Stud Health Technol Inform 2023;302:133-134
  132. Kraemer AI, Chong C, Huber F, Pak H, Stevenson BJ, Müller M, Michaux J, Altimiras ER, Rusakiewicz S, Simó-Riudalbas L, Planet E, Wiznerowicz M, Dagher J, Trono D, Coukos G, Tissot S, Bassani-Sternberg M. The immunopeptidome landscape associated with T cell infiltration, inflammation and immune editing in lung cancer. Nat Cancer 2023;4(5):608-628
  133. Krapp LF, Abriata LA, Cortés Rodriguez F, Dal Peraro M. PeSTo: parameter-free geometric deep learning for accurate prediction of protein binding interfaces. Nat Commun 2023;14(1):2175
  134. Krebs FS, Moura B, Missiaglia E, Aedo-Lopez V, Michielin O, Tsantoulis P, Bisig B, Trimech M, Zoete V, Homicsko K. Response and Resistance to Trametinib in MAP2K1-Mutant Triple-Negative Melanoma. Int J Mol Sci 2023;24(5):4520
  135. Krefl D, Brandulas Cammarata A, Bergmann S. PascalX: a Python library for GWAS gene and pathway enrichment tests. Bioinformatics 2023;39(5):btad296
  136. Kribelbauer JF, Pushkarev O, Gardeux V, Russeil J, van Mierlo G, Deplancke B. Context transcription factors establish cooperative environments and mediate enhancer communication 2023
  137. Kropivsek K, Kachel P, Goetze S, Wegmann R, Festl Y, Severin Y, Hale BD, Mena J, van Drogen A, Dietliker N, Tchinda J, Wollscheid B, Manz MG, Snijder B. Ex vivo drug response heterogeneity reveals personalized therapeutic strategies for patients with multiple myeloma. Nat Cancer 2023;4(5):734-753
  138. Kryshtafovych A, Antczak M, Szachniuk M, Zok T, Kretsch RC, Rangan R, Pham P, Das R, Robin X, Studer G, Durairaj J, Eberhardt J, Sweeney A, Topf M, Schwede T, Fidelis K, Moult J. New prediction categories in CASP15. Proteins 2023
  139. Kuhlmeier E, Chan T, Agüí CV, Willi B, Wolfensberger A, Beisel C, Topolsky I, Beerenwinkel N, Stadler T, Swiss Sars-CoV-Sequencing Consortium, Jones S, Tyson G, Hosie MJ, Reitt K, Hüttl J, Meli ML, Hofmann-Lehmann R. Detection and Molecular Characterization of the SARS-CoV-2 Delta Variant and the Specific Immune Response in Companion Animals in Switzerland. Viruses 2023;15(1):245
  140. Kuznetsov D, Tegenfeldt F, Manni M, Seppey M, Berkeley M, Kriventseva EV, Zdobnov EM. OrthoDB v11: annotation of orthologs in the widest sampling of organismal diversity. Nucleic Acids Res 2023;51(d1):D445-D451
  141. Labbé F, Abdeladhim M, Abrudan J, Araki AS, Araujo RN, Arensburger P, Benoit JB, Brazil RP, Bruno RV, Bueno da Silva Rivas G, Carvalho de Abreu V, Charamis J, Coutinho-Abreu IV, da Costa-Latgé SG, Darby A, Dillon VM, Emrich SJ, Fernandez-Medina D, Figueiredo Gontijo N, Flanley CM, Gatherer D, Genta FA, Gesing S, Giraldo-Calderón GI, Gomes B, Aguiar ERGR, Hamilton JGC, Hamarsheh O, Hawksworth M, Hendershot JM, Hickner PV, Imler JL, Ioannidis P, Jennings EC, Kamhawi S, Karageorgiou C, Kennedy RC, Krueger A, Latorre-Estivalis JM, Ligoxygakis P, Meireles-Filho ACA, Minx P, Miranda JC, Montague MJ, Nowling RJ, Oliveira F, Ortigão-Farias J, Pavan MG, Horacio Pereira M, Nobrega Pitaluga A, Proveti Olmo R, Ramalho-Ortigao M, Ribeiro JMC, Rosendale AJ, Sant'Anna MRV, Scherer SE, Secundino NFC, Shoue DA, da Silva Moraes C, Gesto JSM, Souza NA, Syed Z, Tadros S, Teles-de-Freitas R, Telleria EL, Tomlinson C, Traub-Csekö YM, Marques JT, Tu Z, Unger MF, Valenzuela J, Ferreira FV, de Oliveira KPV, Vigoder FM, Vontas J, Wang L, Weedall GD, Zhioua E, Richards S, Warren WC, Waterhouse RM, Dillon RJ, McDowell MA. Genomic analysis of two phlebotomine sand fly vectors of Leishmania from the New and Old World. PLoS Negl Trop Dis 2023;17(4):e0010862
  142. Laganenka L, Lee JW, Malfertheiner L, Dieterich CL, Fuchs L, Piel J, von Mering C, Sourjik V, Hardt WD. Chemotaxis and autoinducer-2 signalling mediate colonization and contribute to co-existence of Escherichia coli strains in the murine gut. Nat Microbiol 2023;8(2):204-217
  143. Lakkaraju AK, Tejero O, Guixà-González R, Cecco ED, Jungo M, Tsai C, Mastromartino R, Marino J, Deupi X, Hornemann S, Schertler GF, Aguzzi A. The adhesion GPCR Adgrd1 is a prion protein receptor and a mediator of prion cytotoxicity 2023
  144. Lambuta RA, Nanni L, Liu Y, Diaz-Miyar J, Iyer A, Tavernari D, Katanayeva N, Ciriello G, Oricchio E. Whole-genome doubling drives oncogenic loss of chromatin segregation. Nature 2023;615(7954):925-933
  145. Laure A, Rigutto A, Kirschner MB, Opitz L, Grob L, Opitz I, Felley-Bosco E, Hiltbrunner S, Curioni-Fontecedro A. Genomic and Transcriptomic Analyses of Malignant Pleural Mesothelioma (MPM) Samples Reveal Crucial Insights for Preclinical Testing. Cancers (Basel) 2023;15(10):2813
  146. Lavanchy E, Goudet J. Effect of reduced genomic representation on using runs of homozygosity for inbreeding characterization. Mol Ecol Resour 2023;23(4):787-802
  147. Lawless D, McKennan CG, Das SR, Junier T, Xu ZM, Anderson LJ, Gebretsadik T, Shilts MH, Larkin E, Rosas-Salazar C, Chappell JD, Fellay J, Hartert TV. Viral Genetic Determinants of Prolonged Respiratory Syncytial Virus Infection Among Infants in a Healthy Term Birth Cohort. J Infect Dis 2023;227(10):1194-1202
  148. Lee J, Hadfield J, Black A, Sibley TR, Neher RA, Bedford T, Huddleston J. Joint visualization of seasonal influenza serology and phylogeny to inform vaccine composition. Front Bioinform 2023;3:1069487
  149. Loiseau C, Windels EM, Gygli SM, Jugheli L, Maghradze N, Brites D, Ross A, Goig G, Reinhard M, Borrell S, Trauner A, Dötsch A, Aspindzelashvili R, Denes R, Reither K, Beisel C, Tukvadze N, Avaliani Z, Stadler T, Gagneux S. The relative transmission fitness of multidrug-resistant Mycobacterium tuberculosis in a drug resistance hotspot. Nat Commun 2023;14(1):1988
  150. Lombard F, Bourdin G, Pesant S, Agostini S, Baudena A, Boissin E, Cassar N, Clampitt M, Conan P, Da Silva O, Dimier C, Douville E, Elineau A, Fin J, Flores JM, Ghiglione JF, Hume BCC, Jalabert L, John SG, Kelly RL, Koren I, Lin Y, Marie D, McMinds R, Mériguet Z, Metzl N, Paz-García DA, Pedrotti ML, Poulain J, Pujo-Pay M, Ras J, Reverdin G, Romac S, Rouan A, Röttinger E, Vardi A, Voolstra CR, Moulin C, Iwankow G, Banaigs B, Bowler C, de Vargas C, Forcioli D, Furla P, Galand PE, Gilson E, Reynaud S, Sunagawa S, Sullivan MB, Thomas OP, Troublé R, Thurber RV, Wincker P, Zoccola D, Allemand D, Planes S, Boss E, Gorsky G. Open science resources from the Tara Pacific expedition across coral reef and surface ocean ecosystems. Sci Data 2023;10(1):324
  151. Long Y, Vetter R, Iber D. 2D Effects Enhance Precision of Gradient-Based Tissue Patterning 2023
  152. Lopez Vazquez A, Allenbach Petrolati L, Legris M, Dessimoz C, Lampugnani ER, Glover N, Fankhauser C. Protein S-acylation controls the subcellular localization and biological activity of PHYTOCHROME KINASE SUBSTRATE. Plant Cell 2023;35(7):2635-2653
  153. Luo XG, Kuipers J, Beerenwinkel N. Joint inference of exclusivity patterns and recurrent trajectories from tumor mutation trees. Nat Commun 2023;14(1):3676
  154. Luqman H, Wegmann D, Fior S, Widmer A. Climate-induced range shifts drive adaptive response via spatio-temporal sieving of alleles. Nat Commun 2023;14(1):1080
  155. Lussi YC, Magrane M, Martin MJ, Orchard S, UniProt Consortium. Searching and Navigating UniProt Databases. Curr Protoc 2023;3(3):e700
  156. Lütge A, Lu J, Hüllein J, Walther T, Sellner L, Wu B, Rosenquist R, Oakes CC, Dietrich S, Huber W, Zenz T. Subgroup-specific gene expression profiles and mixed epistasis in chronic lymphocytic leukemia. Haematologica 2023
  157. Lütge M, De Martin A, Gil-Cruz C, Perez-Shibayama C, Stanossek Y, Onder L, Cheng HW, Kurz L, Cadosch N, Soneson C, Robinson MD, Stoeckli SJ, Ludewig B, Pikor NB. Conserved stromal-immune cell circuits secure B cell homeostasis and function. Nat Immunol 2023;24(7):1149-1160
  158. Macnair W, Robinson M. SampleQC: robust multivariate, multi-cell type, multi-sample quality control for single-cell data. Genome Biol 2023;24(1):23
  159. Mao K, Borel C, Ansar M, Jolly A, Makrythanasis P, Froehlich C, Iwaszkiewicz J, Wang B, Xu X, Li Q, Blanc X, Zhu H, Chen Q, Jin F, Ankamreddy H, Singh S, Zhang H, Wang X, Chen P, Ranza E, Paracha SA, Shah SF, Guida V, Piceci-Sparascio F, Melis D, Dallapiccola B, Digilio MC, Novelli A, Magliozzi M, Fadda MT, Streff H, Machol K, Lewis RA, Zoete V, Squeo GM, Prontera P, Mancano G, Gori G, Mariani M, Selicorni A, Psoni S, Fryssira H, Douzgou S, Marlin S, Biskup S, De Luca A, Merla G, Zhao S, Cox TC, Groves AK, Lupski JR, Zhang Q, Zhang YB, Antonarakis SE. FOXI3 pathogenic variants cause one form of craniofacial microsomia. Nat Commun 2023;14(1):2026
  160. Marcinkevics R, Silva PN, Hankele AK, Dörnte C, Kadelka S, Csik K, Godbersen S, Goga A, Hasenöhrl L, Hirschi P, Kabakci H, LaPierre MP, Mayrhofer J, Title AC, Shu X, Baiioud N, Bernal S, Dassisti L, Saenz-de-Juano MD, Schmidhauser M, Silvestrelli G, Ulbrich SZ, Ulbrich TJ, Wyss T, Stekhoven DJ, Al-Quaddoomi FS, Yu S, Binder M, Schultheiß C, Zindel C, Kolling C, Goldhahn J, Seighalani BK, Zjablovskaja P, Hardung F, Schuster M, Richter A, Huang YJ, Lauer G, Baurmann H, Low JS, Vaqueirinho D, Jovic S, Piccoli L, Ciesek S, Vogt JE, Sallusto F, Stoffel M, Ulbrich SE. Machine learning analysis of humoral and cellular responses to SARS-CoV-2 infection in young adults. Front Immunol 2023;14:1158905
  161. Marconato L, Palla G, Yamauchi KA, Virshup I, Heidari E, Treis T, Toth M, Shrestha RB, Vöhringer H, Huber W, Gerstung M, Moore J, Theis FJ, Stegle O. SpatialData: an open and universal data framework for spatial omics 2023
  162. Marrec L, Bank C. Evolutionary rescue in a fluctuating environment: periodic versus quasi-periodic environmental changes. Proc Biol Sci 2023;290(1999):20230770
  163. Martani A, Geneviève LD, Wangmo T, Maurer J, Crameri K, Erard F, Spoendlin J, Pauli-Magnus C, Pittet V, Sengstag T, Soldini E, Hirschel B, Borisch B, Kruschel Weber C, Zwahlen M, Elger BS. Sensing the (digital) pulse. Future steps for improving the secondary use of data for research in Switzerland. Digit Health 2023;9:20552076231169826
  164. Marx AF, Kallert SM, Brunner TM, Villegas JA, Geier F, Fixemer J, Abreu-Mota T, Reuther P, Bonilla WV, Fadejeva J, Kreutzfeldt M, Wagner I, Aparicio-Domingo P, Scarpellino L, Charmoy M, Utzschneider DT, Hagedorn C, Lu M, Cornille K, Stauffer K, Kreppel F, Merkler D, Zehn D, Held W, Luther SA, Löhning M, Pinschewer DD. The alarmin interleukin-33 promotes the expansion and preserves the stemness of Tcf-1+ CD8+ T cells in chronic viral infection. Immunity 2023;56(4):813-828.e10
  165. Mastelic-Gavillet B, Sarivalasis A, Lozano LE, Lofek S, Wyss T, Melero I, de Vries IJM, Harari A, Romero P, Kandalaft LE, Viganó S. Longitudinal analysis of DC subsets in patients with ovarian cancer: Implications for immunotherapy. Front Immunol 2023;14:1119371
  166. Mathieson I, Day FR, Barban N, Tropf FC, Brazel DM, eQTLGen Consortium, BIOS Consortium, Vaez A, van Zuydam N, Bitarello BD, Gardner EJ, Akimova ET, Azad A, Bergmann S, Bielak LF, Boomsma DI, Bosak K, Brumat M, Buring JE, Cesarini D, Chasman DI, Chavarro JE, Cocca M, Concas MP, Davey Smith G, Davies G, Deary IJ, Esko T, Faul JD, FinnGen Study, Franco O, Ganna A, Gaskins AJ, Gelemanovic A, de Geus EJC, Gieger C, Girotto G, Gopinath B, Grabe HJ, Gunderson EP, Hayward C, He C, van Heemst D, Hill WD, Hoffmann ER, Homuth G, Hottenga JJ, Huang H, Hyppӧnen E, Ikram MA, Jansen R, Johannesson M, Kamali Z, Kardia SLR, Kavousi M, Kifley A, Kiiskinen T, Kraft P, Kühnel B, Langenberg C, Liew G, Lifelines Cohort Study, Lind PA, Luan J, Mägi R, Magnusson PKE, Mahajan A, Martin NG, Mbarek H, McCarthy MI, McMahon G, Medland SE, Meitinger T, Metspalu A, Mihailov E, Milani L, Missmer SA, Mitchell P, Møllegaard S, Mook-Kanamori DO, Morgan A, van der Most PJ, de Mutsert R, Nauck M, Nolte IM, Noordam R, Penninx BWJH, Peters A, Peyser PA, Polašek O, Power C, Pribisalic A, Redmond P, Rich-Edwards JW, Ridker PM, Rietveld CA, Ring SM, Rose LM, Rueedi R, Shukla V, Smith JA, Stankovic S, Stefánsson K, Stöckl D, Strauch K, Swertz MA, Teumer A, Thorleifsson G, Thorsteinsdottir U, Thurik AR, Timpson NJ, Turman C, Uitterlinden AG, Waldenberger M, Wareham NJ, Weir DR, Willemsen G, Zhao JH, Zhao W, Zhao Y, Snieder H, den Hoed M, Ong KK, Mills MC, Perry JRB. Genome-wide analysis identifies genetic effects on reproductive success and ongoing natural selection at the FADS locus. Nat Hum Behav 2023;7(5):790-801
  167. Matuozzo D, Talouarn E, Marchal A, Zhang P, Manry J, Seeleuthner Y, Zhang Y, Bolze A, Chaldebas M, Milisavljevic B, Gervais A, Bastard P, Asano T, Bizien L, Barzaghi F, Abolhassani H, Abou Tayoun A, Aiuti A, Alavi Darazam I, Allende LM, Alonso-Arias R, Arias AA, Aytekin G, Bergman P, Bondesan S, Bryceson YT, Bustos IG, Cabrera-Marante O, Carcel S, Carrera P, Casari G, Chaïbi K, Colobran R, Condino-Neto A, Covill LE, Delmonte OM, El Zein L, Flores C, Gregersen PK, Gut M, Haerynck F, Halwani R, Hancerli S, Hammarström L, Hatipoğlu N, Karbuz A, Keles S, Kyheng C, Leon-Lopez R, Franco JL, Mansouri D, Martinez-Picado J, Metin Akcan O, Migeotte I, Morange PE, Morelle G, Martin-Nalda A, Novelli G, Novelli A, Ozcelik T, Palabiyik F, Pan-Hammarström Q, de Diego RP, Planas-Serra L, Pleguezuelo DE, Prando C, Pujol A, Reyes LF, Rivière JG, Rodriguez-Gallego C, Rojas J, Rovere-Querini P, Schlüter A, Shahrooei M, Sobh A, Soler-Palacin P, Tandjaoui-Lambiotte Y, Tipu I, Tresoldi C, Troya J, van de Beek D, Zatz M, Zawadzki P, Al-Muhsen SZ, Alosaimi MF, Alsohime FM, Baris-Feldman H, Butte MJ, Constantinescu SN, Cooper MA, Dalgard CL, Fellay J, Heath JR, Lau YL, Lifton RP, Maniatis T, Mogensen TH, von Bernuth H, Lermine A, Vidaud M, Boland A, Deleuze JF, Nussbaum R, Kahn-Kirby A, Mentre F, Tubiana S, Gorochov G, Tubach F, Hausfater P, COVID Human Genetic Effort, COVIDeF Study Group, French COVID Cohort Study Group, CoV-Contact Cohort, COVID-STORM Clinicians, COVID Clinicians, Orchestra Working Group, Amsterdam UMC Covid-19 Biobank, NIAID-USUHS COVID Study Group, Meyts I, Zhang SY, Puel A, Notarangelo LD, Boisson-Dupuis S, Su HC, Boisson B, Jouanguy E, Casanova JL, Zhang Q, Abel L, Cobat A. Rare predicted loss-of-function variants of type I IFN immunity genes are associated with life-threatening COVID-19. Genome Med 2023;15(1):22
  168. Mazel-Sanchez B, Niu C, Williams N, Bachmann M, Choltus H, Silva F, Serre-Beinier V, Karenovics W, Iwaszkiewicz J, Zoete V, Kaiser L, Hartley O, Wehrle-Haller B, Schmolke M. Influenza A virus exploits transferrin receptor recycling to enter host cells. Proc Natl Acad Sci U S A 2023;120(21):e2214936120
  169. McBroome J, de Bernardi Schneider A, Roemer C, Wolfinger MT, Hinrichs AS, O’Toole AN, Ruis C, Turakhia Y, Rambaut A, Corbett-Detig R. Automated Agnostic Designation of Pathogen Lineages 2023
  170. Mitamura Y, Reiger M, Kim J, Xiao Y, Zhakparov D, Tan G, Rückert B, Rinaldi AO, Baerenfaller K, Akdis M, Brüggen MC, Nadeau KC, Brunner PM, Roqueiro D, Traidl-Hoffmann C, Akdis CA. Spatial transcriptomics combined with single-cell RNA-sequencing unravels the complex inflammatory cell network in atopic dermatitis. Allergy 2023
  171. Moi D, Dessimoz C. Phylogenetic profiling in eukaryotes comes of age. Proc Natl Acad Sci U S A 2023;120(19):e2305013120
  172. Mottin L, Goldman JP, Jäggli C, Achermann R, Gobeill J, Knafou J, Ehrsam J, Wicky A, Gérard CL, Schwenk T, Charrier M, Tsantoulis P, Lovis C, Leichtle A, Kiessling MK, Michielin O, Pradervand S, Foufi V, Ruch P. Multilingual RECIST classification of radiology reports using supervised learning. Front Digit Health 2023;5:1195017
  173. Mounier N, Kutalik Z. Bias correction for inverse variance weighting Mendelian randomization. Genet Epidemiol 2023;47(4):314-331
  174. Mounier N, Robertson DS, Kutalik Z, Dudbridge F, Bowden J. Incorporating discovery and replication GWAS into summary data Mendelian randomization studies: A review of current methods and a simple, general and powerful alternative 2023
  175. Muri J, Cecchinato V, Cavalli A, Shanbhag AA, Matkovic M, Biggiogero M, Maida PA, Moritz J, Toscano C, Ghovehoud E, Furlan R, Barbic F, Voza A, De Nadai G, Cervia C, Zurbuchen Y, Taeschler P, Murray LA, Danelon-Sargenti G, Moro S, Gong T, Piffaretti P, Bianchini F, Crivelli V, Podešvová L, Pedotti M, Jarrossay D, Sgrignani J, Thelen S, Uhr M, Bernasconi E, Rauch A, Manzo A, Ciurea A, Rocchi MBL, Varani L, Moser B, Bottazzi B, Thelen M, Fallon BA, Boyman O, Mantovani A, Garzoni C, Franzetti-Pellanda A, Uguccioni M, Robbiani DF. Autoantibodies against chemokines post-SARS-CoV-2 infection correlate with disease course. Nat Immunol 2023;24(4):604-611
  176. Nadeau S, Devaux A, Bagutti C, Alt M, Hampe EI, Kraus M, Würfel E, Koch KN, Fuchs S, Tschudin-Sutter S, Holschneider A, Ort C, Chen C, Huisman JS, Julian TR, Stadler T. Influenza transmission dynamics quantified from wastewater 2023
  177. Nadeau SA, Vaughan TG, Beckmann C, Topolsky I, Chen C, Hodcroft E, Schär T, Nissen I, Santacroce N, Burcklen E, Ferreira P, Jablonski KP, Posada-Céspedes S, Capece V, Seidel S, Santamaria de Souza N, Martinez-Gomez JM, Cheng P, Bosshard PP, Levesque MP, Kufner V, Schmutz S, Zaheri M, Huber M, Trkola A, Cordey S, Laubscher F, Gonçalves AR, Aeby S, Pillonel T, Jacot D, Bertelli C, Greub G, Leuzinger K, Stange M, Mari A, Roloff T, Seth-Smith H, Hirsch HH, Egli A, Redondo M, Kobel O, Noppen C, du Plessis L, Beerenwinkel N, Neher RA, Beisel C, Stadler T. Swiss public health measures associated with reduced SARS-CoV-2 transmission using genome data. Sci Transl Med 2023;15(680):eabn7979
  178. Naghavian R, Faigle W, Oldrati P, Wang J, Toussaint NC, Qiu Y, Medici G, Wacker M, Freudenmann LK, Bonté PE, Weller M, Regli L, Amigorena S, Rammensee HG, Walz JS, Brugger SD, Mohme M, Zhao Y, Sospedra M, Neidert MC, Martin R. Microbial peptides activate tumour-infiltrating lymphocytes in glioblastoma. Nature 2023;617(7962):807-817
  179. Neuenschwander S, Cruz Dávalos DI, Anchieri L, Sousa da Mota B, Bozzi D, Rubinacci S, Delaneau O, Rasmussen S, Malaspinas AS. Mapache: a flexible pipeline to map ancient DNA. Bioinformatics 2023;39(2):btad028
  180. Neves A, Walther D, Martin-Campos T, Barbie V, Bertelli C, Blanc D, Bouchet G, Erard F, Greub G, Hirsch HH, Huber M, Kaiser L, Leib SL, Leuzinger K, Lazarevic V, Mäusezahl M, Molina J, Neher RA, Perreten V, Ramette A, Roloff T, Schrenzel J, Seth-Smith HMB, Stephan R, Terumalai D, Wegner F, Egli A. The Swiss Pathogen Surveillance Platform - towards a nation-wide One Health data exchange platform for bacterial, viral and fungal genomics and associated metadata. Microb Genom 2023;9(5)
  181. Noel B, Denoeud F, Rouan A, Buitrago-López C, Capasso L, Poulain J, Boissin E, Pousse M, Da Silva C, Couloux A, Armstrong E, Carradec Q, Cruaud C, Labadie K, Lê-Hoang J, Tambutté S, Barbe V, Moulin C, Bourdin G, Iwankow G, Romac S, Agostini S, Banaigs B, Boss E, Bowler C, de Vargas C, Douville E, Flores JM, Forcioli D, Furla P, Galand PE, Lombard F, Pesant S, Reynaud S, Sullivan MB, Sunagawa S, Thomas OP, Troublé R, Thurber RV, Allemand D, Planes S, Gilson E, Zoccola D, Wincker P, Voolstra CR, Aury JM. Pervasive tandem duplications and convergent evolution shape coral genomes. Genome Biol 2023;24(1):123
  182. Noll N, Molari M, Shaw LP, Neher RA. PanGraph: scalable bacterial pan-genome graph construction. Microb Genom 2023;9(6)
  183. O’Toole Á, Neher RA, Ndodo N, Borges V, Gannon B, Gomes JP, Groves N, King DJ, Maloney D, Lemey P, Lewandowski K, Loman N, Myers R, Suchard MA, Worobey M, Chand M, Ihekweazu C, Ulaeto D, Adetifa I, Rambaut A. Putative APOBEC3 deaminase editing in MPXV as evidence for sustained human transmission since at least 2016 2023
  184. Ollila HM, Sharon E, Lin L, Sinnott-Armstrong N, Ambati A, Yogeshwar SM, Hillary RP, Jolanki O, Faraco J, Einen M, Luo G, Zhang J, Han F, Yan H, Dong XS, Li J, Zhang J, Hong SC, Kim TW, Dauvilliers Y, Barateau L, Lammers GJ, Fronczek R, Mayer G, Santamaria J, Arnulf I, Knudsen-Heier S, Bredahl MKL, Thorsby PM, Plazzi G, Pizza F, Moresco M, Crowe C, Van den Eeden SK, Lecendreux M, Bourgin P, Kanbayashi T, Martínez-Orozco FJ, Peraita-Adrados R, Benetó A, Montplaisir J, Desautels A, Huang YS, FinnGen, Jennum P, Nevsimalova S, Kemlink D, Iranzo A, Overeem S, Wierzbicka A, Geisler P, Sonka K, Honda M, Högl B, Stefani A, Coelho FM, Mantovani V, Feketeova E, Wadelius M, Eriksson N, Smedje H, Hallberg P, Hesla PE, Rye D, Pelin Z, Ferini-Strambi L, Bassetti CL, Mathis J, Khatami R, Aran A, Nampoothiri S, Olsson T, Kockum I, Partinen M, Perola M, Kornum BR, Rueger S, Winkelmann J, Miyagawa T, Toyoda H, Khor SS, Shimada M, Tokunaga K, Rivas M, Pritchard JK, Risch N, Kutalik Z, O'Hara R, Hallmayer J, Ye CJ, Mignot EJ. Narcolepsy risk loci outline role of T cell autoimmunity and infectious triggers in narcolepsy. Nat Commun 2023;14(1):2709
  185. Ory F, Dietemann V, Guisolan A, von Ah U, Fleuti C, Oberhaensli S, Charrière JD, Dainat B. Paenibacillus melissococcoides sp. nov., isolated from a honey bee colony affected by European foulbrood disease. Int J Syst Evol Microbiol 2023;73(4)
  186. Papkou A, Garcia-Pastor L, Escudero JA, Wagner A. A rugged yet easily navigable fitness landscape of antibiotic resistance 2023
  187. Parey E, Louis A, Montfort J, Bouchez O, Roques C, Iampietro C, Lluch J, Castinel A, Donnadieu C, Desvignes T, Floi Bucao C, Jouanno E, Wen M, Mejri S, Dirks R, Jansen H, Henkel C, Chen WJ, Zahm M, Cabau C, Klopp C, Thompson AW, Robinson-Rechavi M, Braasch I, Lecointre G, Bobe J, Postlethwait JH, Berthelot C, Roest Crollius H, Guiguen Y. Genome structures resolve the early diversification of teleost fishes. Science 2023;379(6632):572-575
  188. Pasche E, Mottaz A, Gobeill J, Michel PA, Caucheteur D, Naderi N, Ruch P. Assessing the use of supplementary materials to improve genomic variant discovery. Database (Oxford) 2023;2023:baad017
  189. Paysan-Lafosse T, Blum M, Chuguransky S, Grego T, Pinto BL, Salazar GA, Bileschi ML, Bork P, Bridge A, Colwell L, Gough J, Haft DH, Letunić I, Marchler-Bauer A, Mi H, Natale DA, Orengo CA, Pandurangan AP, Rivoire C, Sigrist CJA, Sillitoe I, Thanki N, Thomas PD, Tosatto SCE, Wu CH, Bateman A. InterPro in 2022. Nucleic Acids Res 2023;51(d1):D418-D427
  190. PCAWG Transcriptome Core Group, Calabrese C, Davidson NR, Demircioğlu D, Fonseca NA, He Y, Kahles A, Lehmann KV, Liu F, Shiraishi Y, Soulette CM, Urban L, Greger L, Li S, Liu D, Perry MD, Xiang Q, Zhang F, Zhang J, Bailey P, Erkek S, Hoadley KA, Hou Y, Huska MR, Kilpinen H, Korbel JO, Marin MG, Markowski J, Nandi T, Pan-Hammarström Q, Pedamallu CS, Siebert R, Stark SG, Su H, Tan P, Waszak SM, Yung C, Zhu S, Awadalla P, Creighton CJ, Meyerson M, Ouellette BFF, Wu K, Yang H, PCAWG Transcriptome Working Group, Brazma A, Brooks AN, Göke J, Rätsch G, Schwarz RF, Stegle O, Zhang Z, PCAWG Consortium. Author Correction: Genomic basis for RNA alterations in cancer. Nature 2023;614(7948):E37
  191. Pfaendler R, Hanimann J, Lee S, Snijder B. Self-supervised vision transformers accurately decode cellular state heterogeneity 2023
  192. Pfefferli C, Bonvin M, Grepper D, Robatel S, König D, Lischer HEL, Bruggmann R, Jaźwińska A. Parallels between oncogene-driven cardiac hyperplasia and heart regeneration in zebrafish. Development 2023;150(12):dev201412
  193. Pitton M, Valente LG, Oberhaensli S, Casanova C, Sendi P, Schnegg B, Jakob SM, Cameron DR, Que YA, Fürholz M. Dynamics of bacterial pathogens at the driveline exit site in patients with ventricular assist devices: a prospective, observational, single-centre cohort study. J Heart Lung Transplant 2023:S1053-2498(23)01871-5
  194. Piwecka M, Luisier R, Andreassi C. Editorial: RNA at a breaking point? Cytoplasmic cleavage and other post-transcriptional RNA processing in neurodevelopment and disease. Front Mol Neurosci 2023;16:1214853
  195. Planas-Paz L, Pliego-Mendieta A, Hagedorn C, Aguilera-Garcia D, Haberecker M, Arnold F, Herzog M, Bankel L, Guggenberger R, Steiner S, Chen Y, Kahraman A, Zoche M, Rubin MA, Moch H, Britschgi C, Pauli C. Unravelling homologous recombination repair deficiency and therapeutic opportunities in soft tissue and bone sarcoma. EMBO Mol Med 2023;15(4):e16863
  196. Prummer M, Bertolini A, Bosshard L, Barkmann F, Yates J, Boeva V, Tumor Profiler Consortium , Stekhoven D, Singer F. scROSHI: robust supervised hierarchical identification of single cells. NAR Genom Bioinform 2023;5(2):lqad058
  197. Racle J, Guillaume P, Schmidt J, Michaux J, Larabi A, Lau K, Perez MAS, Croce G, Genolet R, Coukos G, Zoete V, Pojer F, Bassani-Sternberg M, Harari A, Gfeller D. Machine learning predictions of MHC-II specificities reveal alternative binding mode of class II epitopes. Immunity 2023;56(6):1359-1375.e13
  198. Radoux-Mergault A, Oberhauser L, Aureli S, Gervasio FL, Stoeber M. Subcellular location defines GPCR signal transduction. Sci Adv 2023;9(16):eadf6059
  199. Ramon C, Stelling J. Functional comparison of metabolic networks across species. Nat Commun 2023;14(1):1699
  200. Ratti A, Fassi EMA, Forlani F, Mori M, Villa F, Cappitelli F, Sgrignani J, Roda G, Cavalli A, Villa S, Grazioso G. Mechanistic Insights into the Antibiofilm Mode of Action of Ellagic Acid. Pharmaceutics 2023;15(6):1757
  201. Reichmuth ML, Hodcroft EB, Althaus CL. Importation of Alpha and Delta variants during the SARS-CoV-2 epidemic in Switzerland: phylogenetic analysis and intervention scenarios 2023
  202. Rheinbay E, Nielsen MM, Abascal F, Wala JA, Shapira O, Tiao G, Hornshøj H, Hess JM, Juul RI, Lin Z, Feuerbach L, Sabarinathan R, Madsen T, Kim J, Mularoni L, Shuai S, Lanzós A, Herrmann C, Maruvka YE, Shen C, Amin SB, Bandopadhayay P, Bertl J, Boroevich KA, Busanovich J, Carlevaro-Fita J, Chakravarty D, Chan CWY, Craft D, Dhingra P, Diamanti K, Fonseca NA, Gonzalez-Perez A, Guo Q, Hamilton MP, Haradhvala NJ, Hong C, Isaev K, Johnson TA, Juul M, Kahles A, Kahraman A, Kim Y, Komorowski J, Kumar K, Kumar S, Lee D, Lehmann KV, Li Y, Liu EM, Lochovsky L, Park K, Pich O, Roberts ND, Saksena G, Schumacher SE, Sidiropoulos N, Sieverling L, Sinnott-Armstrong N, Stewart C, Tamborero D, Tubio JMC, Umer HM, Uusküla-Reimand L, Wadelius C, Wadi L, Yao X, Zhang CZ, Zhang J, Haber JE, Hobolth A, Imielinski M, Kellis M, Lawrence MS, von Mering C, Nakagawa H, Raphael BJ, Rubin MA, Sander C, Stein LD, Stuart JM, Tsunoda T, Wheeler DA, Johnson R, Reimand J, Gerstein M, Khurana E, Campbell PJ, López-Bigas N, PCAWG Drivers and Functional Interpretation Working Group, PCAWG Structural Variation Working Group, Weischenfeldt J, Beroukhim R, Martincorena I, Pedersen JS, Getz G, PCAWG Consortium. Author Correction: Analyses of non-coding somatic drivers in 2,658 cancer whole genomes. Nature 2023;614(7948):E40
  203. Richard-Bollans A, Aitken C, Antonelli A, Bitencourt C, Goyder D, Lucas E, Ondo I, Pérez-Escobar OA, Pironon S, Richardson JE, Russell D, Silvestro D, Wright CW, Howes MR. Machine learning enhances prediction of plants as potential sources of antimalarials. Front Plant Sci 2023;14:1173328
  204. Rieder J, Kapopoulou A, Bank C, Adrian-Kalchhauser I. Metagenomics and metabarcoding experimental choices and their impact on microbial community characterization in freshwater recirculating aquaculture systems. Environ Microbiome 2023;18(1):8
  205. Rizzi V, Aureli S, Ansari N, Gervasio FL. OneOPES, a combined enhanced sampling method to rule them all 2023
  206. Rocca-Serra P, Gu W, Ioannidis V, Abbassi-Daloii T, Capella-Gutierrez S, Chandramouliswaran I, Splendiani A, Burdett T, Giessmann RT, Henderson D, Batista D, Emam I, Gadiya Y, Giovanni L, Willighagen E, Evelo C, Gray AJG, Gribbon P, Juty N, Welter D, Quast K, Peeters P, Plasterer T, Wood C, van der Horst E, Reilly D, van Vlijmen H, Scollen S, Lister A, Thurston M, Granell R, FAIR Cookbook Contributors, Sansone SA. The FAIR Cookbook - the essential resource for and by FAIR doers. Sci Data 2023;10(1):292
  207. Rodrigues PF, Kouklas A, Cvijetic G, Bouladoux N, Mitrovic M, Desai JV, Lima-Junior DS, Lionakis MS, Belkaid Y, Ivanek R, Tussiwand R. pDC-like cells are pre-DC2 and require KLF4 to control homeostatic CD4 T cells. Sci Immunol 2023;8(80):eadd4132
  208. Röhrig UF, Goullieux M, Bugnon M, Zoete V. Attracting Cavities 2.0: Improving the Flexibility and Robustness for Small-Molecule Docking. J Chem Inf Model 2023;63(12):3925-3940
  209. Romanens L, Chaskar P, Marcone R, Ryser S, Tille JC, Genolet R, Heimgartner-Hu K, Heimgartner K, Moore JS, Liaudet N, Kaya G, Pittet MJ, Dietrich PY, Delorenzi M, Speiser DE, Harari A, Tsantoulis P, Labidi-Galy SI. Clonal expansion of intra-epithelial T cells in breast cancer revealed by spatial transcriptomics. Int J Cancer 2023
  210. Rouan A, Pousse M, Djerbi N, Porro B, Bourdin G, Carradec Q, Hume BC, Poulain J, Lê-Hoang J, Armstrong E, Agostini S, Salazar G, Ruscheweyh HJ, Aury JM, Paz-García DA, McMinds R, Giraud-Panis MJ, Deshuraud R, Ottaviani A, Morini LD, Leone C, Wurzer L, Tran J, Zoccola D, Pey A, Moulin C, Boissin E, Iwankow G, Romac S, de Vargas C, Banaigs B, Boss E, Bowler C, Douville E, Flores M, Reynaud S, Thomas OP, Troublé R, Thurber RV, Planes S, Allemand D, Pesant S, Galand PE, Wincker P, Sunagawa S, Röttinger E, Furla P, Voolstra CR, Forcioli D, Lombard F, Gilson E. Telomere DNA length regulation is influenced by seasonal temperature differences in short-lived but not in long-lived reef-building corals. Nat Commun 2023;14(1):3038
  211. Rozzi R, Lomolino MV, van der Geer AAE, Silvestro D, Lyons SK, Bover P, Alcover JA, Benítez-López A, Tsai CH, Fujita M, Kubo MO, Ochoa J, Scarborough ME, Turvey ST, Zizka A, Chase JM. Dwarfism and gigantism drive human-mediated extinctions on islands. Science 2023;379(6636):1054-1059
  212. Rubinacci S, Hofmeister RJ, Sousa da Mota B, Delaneau O. Imputation of low-coverage sequencing data from 150,119 UK Biobank genomes. Nat Genet 2023
  213. Ruiz F, Peter B, Rebeaud J, Vigne S, Bressoud V, Roumain M, Wyss T, Yersin Y, Wagner I, Kreutzfeldt M, Pimentel Mendes M, Kowalski C, Boivin G, Roth L, Schwaninger M, Merkler D, Muccioli GG, Hugues S, Petrova TV, Pot C. Endothelial cell-derived oxysterol ablation attenuates experimental autoimmune encephalomyelitis. EMBO Rep 2023;24(3):e55328
  214. Sabatier M, Birsen R, Lauture L, Mouche S, Angelino P, Dehairs J, Goupille L, Boussaid I, Heiblig M, Boet E, Sahal A, Saland E, Santos JC, Armengol M, Fernandez-Serrano M, Farge T, Cognet G, Simonetta F, Pignon C, Graffeuil A, Mazzotti C, Avet-Loiseau H, Delos O, Bertrand-Michel J, Chedru A, Dembitz V, Gallipoli P, Anstee NS, Loo S, Wei AH, Carroll M, Goubard A, Castellano R, Collette Y, Vergez F, Mansat-De Mas V, Bertoli S, Tavitian S, Picard M, Recher C, Bourges-Abella N, Granat F, Kosmider O, Sujobert P, Colsch B, Joffre C, Stuani L, Swinnen JV, Guillou H, Roue G, Hakim N, Dejean AS, Tsantoulis P, Larrue C, Bouscary D, Tamburini J, Sarry JE. C/EBPa confers dependence to fatty acid anabolic pathways and vulnerability to lipid oxidative stress-induced ferroptosis in FLT3-mutant leukemia. Cancer Discov 2023:CD-22-0411
  215. Sadler MC, Auwerx C, Deelen P, Kutalik Z. Multi-layered genetic approaches to identify approved drug targets 2023
  216. Saini JS, Manni M, Hassler C, Cable RN, Duhaime MB, Zdobnov EM. Genomic insights into the coupling of a Chlorella-like microeukaryote and sulfur bacteria in the chemocline of permanently stratified Lake Cadagno. ISME J 2023;17(6):903-915
  217. Sajibu S, Sonder E, Tiwari A, Orjuela S, Parker HR, The Frans O, Gubler C, Marra G, Robinson MD. Validation of hypermethylated DNA regions found in colorectal cancers as potential aging-independent biomarkers of precancerous colorectal lesions 2023
  218. Sandoz PA, Denhardt-Eriksson RA, Abrami L, Abriata LA, Spreemann G, Maclachlan C, Ho S, Kunz B, Hess K, Knott G, S Mesquita F, Hatzimanikatis V, van der Goot FG. Dynamics of CLIMP-63 S-acylation control ER morphology. Nat Commun 2023;14(1):264
  219. Sannino C, Qi W, Rüthi J, Stierli B, Frey B. Distinct taxonomic and functional profiles of high Arctic and alpine permafrost-affected soil microbiomes. Environ Microbiome 2023;18(1):54
  220. Santos-Moreno J, Tasiudi E, Kusumawardhani H, Stelling J, Schaerli Y. Robustness and innovation in synthetic genotype networks. Nat Commun 2023;14(1):2454
  221. Sarkis R, Burri O, Royer-Chardon C, Schyrr F, Blum S, Costanza M, Cherix S, Piazzon N, Barcena C, Bisig B, Nardi V, Sarro R, Ambrosini G, Weigert M, Spertini O, Blum S, Deplancke B, Seitz A, de Leval L, Naveiras O. MarrowQuant 2.0: A Digital Pathology Workflow Assisting Bone Marrow Evaluation in Experimental and Clinical Hematology. Mod Pathol 2023;36(4):100088
  222. Sarton-Lohéac G, Nunes da Silva CG, Mazel F, Baud G, de Bakker V, Das S, El Chazli Y, Ellegaard K, Garcia-Garcera M, Glover N, Liberti J, Nacif Marçal L, Prasad A, Somerville V, SAGE class 2019-2020 and 2020-2021, Bonilla-Rosso G, Engel P. Deep Divergence and Genomic Diversification of Gut Symbionts of Neotropical Stingless Bees. mBio 2023;14(2):e0353822
  223. Schmeing S, Robinson MD. Gapless provides combined scaffolding, gap filling, and assembly correction with long reads. Life Sci Alliance 2023;6(7):e202201471
  224. Schmidt J, Chiffelle J, Perez MAS, Magnin M, Bobisse S, Arnaud M, Genolet R, Cesbron J, Barras D, Navarro Rodrigo B, Benedetti F, Michel A, Queiroz L, Baumgaertner P, Guillaume P, Hebeisen M, Michielin O, Nguyen-Ngoc T, Huber F, Irving M, Tissot-Renaud S, Stevenson BJ, Rusakiewicz S, Dangaj Laniti D, Bassani-Sternberg M, Rufer N, Gfeller D, Kandalaft LE, Speiser DE, Zoete V, Coukos G, Harari A. Neoantigen-specific CD8 T cells with high structural avidity preferentially reside in and eliminate tumors. Nat Commun 2023;14(1):3188
  225. Schmutzer M, Wagner A. Not Quite Lost in Translation: Mistranslation Alters Adaptive Landscape Topography and the Dynamics of Evolution. Mol Biol Evol 2023;40(6):msad136
  226. Schnider B, Escudero FL, Imberty A, Lisacek F. BiotechLec: an interactive guide of commercial lectins for glycobiology and biomedical research applications. Glycobiology 2023:cwad034
  227. Schnidrig D, Garofoli A, Benjak A, Rätsch G, Rubin MA, SOCIBP consortium, Piscuoglio S, Ng CKY. PipeIT2: A tumor-only somatic variant calling workflow for molecular diagnostic Ion Torrent sequencing data. Genomics 2023;115(2):110587
  228. Schoeler T, Speed D, Porcu E, Pirastu N, Pingault JB, Kutalik Z. Participation bias in the UK Biobank distorts genetic associations and downstream analyses. Nat Hum Behav 2023
  229. Schütz SD, Liechti N, Altpeter E, Labutin A, Wütrich T, Schmidt KM, Buettcher M, Moser M, Bruggmann R, Wittwer M. Phylogeography of Francisella tularensis subspecies holarctica and epidemiology of tularemia in Switzerland. Front Microbiol 2023;14:1151049
  230. Schweke H, Xu Q, Tauriello G, Pantolini L, Schwede T, Cazals F, Lhéritier A, Fernandez-Recio J, Rodríguez-Lumbreras LA, Schueler-Furman O, Varga JK, Jiménez-García B, Réau MF, Bonvin AMJJ, Savojardo C, Martelli PL, Casadio R, Tubiana J, Wolfson HJ, Oliva R, Barradas-Bautista D, Ricciardelli T, Cavallo L, Venclovas Č, Olechnovič K, Guerois R, Andreani J, Martin J, Wang X, Terashi G, Sarkar D, Christoffer C, Aderinwale T, Verburgt J, Kihara D, Marchand A, Correia BE, Duan R, Qiu L, Xu X, Zhang S, Zou X, Dey S, Dunbrack RL, Levy ED, Wodak SJ. Discriminating physiological from non-physiological interfaces in structures of protein complexes: A community-wide study. Proteomics 2023:e2200323
  231. Serey-Gaut M, Cortes M, Makrythanasis P, Suri M, Taylor AMR, Sullivan JA, Asleh AN, Mitra J, Dar MA, McNamara A, Shashi V, Dugan S, Song X, Rosenfeld JA, Cabrol C, Iwaszkiewicz J, Zoete V, Pehlivan D, Akdemir ZC, Roeder ER, Littlejohn RO, Dibra HK, Byrd PJ, Stewart GS, Geckinli BB, Posey J, Westman R, Jungbluth C, Eason J, Sachdev R, Evans CA, Lemire G, VanNoy GE, O'Donnell-Luria A, Mau-Them FT, Juven A, Piard J, Nixon CY, Zhu Y, Ha T, Buckley MF, Thauvin C, Essien Umanah GK, Van Maldergem L, Lupski JR, Roscioli T, Dawson VL, Dawson TM, Antonarakis SE. Bi-allelic TTI1 variants cause an autosomal-recessive neurodevelopmental disorder with microcephaly. Am J Hum Genet 2023;110(3):499-515
  232. Servajean R, Bitbol AF. Impact of population size on early adaptation in rugged fitness landscapes. Philos Trans R Soc Lond B Biol Sci 2023;378(1877):20220045
  233. Sgammeglia N, Widmer YF, Kaldun JC, Fritsch C, Bruggmann R, Sprecher SG. Memory phase-specific genes in the Mushroom Bodies identified using CrebB-target DamID. PLoS Genet 2023;19(6):e1010802
  234. Sgarbossa D, Lupo U, Bitbol AF. Generative power of a protein language model trained on multiple sequence alignments. Elife 2023;12:e79854
  235. Shamanskiy V, Mikhailova AA, Tretiakov EO, Ushakova K, Mikhailova AG, Oreshkov S, Knorre DA, Ree N, Overdevest JB, Lukowski SW, Gostimskaya I, Yurov V, Liou CW, Lin TK, Kunz WS, Reymond A, Mazunin I, Bazykin GA, Fellay J, Tanaka M, Khrapko K, Gunbin K, Popadin K. Secondary structure of the human mitochondrial genome affects formation of deletions. BMC Biol 2023;21(1):103
  236. Sianta SA, Peischl S, Moeller DA, Brandvain Y. The efficacy of selection may increase or decrease with selfing depending upon the recombination environment. Evolution 2023;77(2):394-408
  237. Sjaarda J, Delacrétaz A, Dubath C, Laaboub N, Piras M, Grosu C, Vandenberghe F, Crettol S, Ansermot N, Gamma F, Plessen KJ, von Gunten A, Conus P, Kutalik Z, Eap CB. Identification of four novel loci associated with psychotropic drug-induced weight gain in a Swiss psychiatric longitudinal study: A GWAS analysis. Mol Psychiatry 2023
  238. Sjaarda J, Kutalik Z. Partner choice, confounding and trait convergence all contribute to phenotypic partner similarity. Nat Hum Behav 2023;7(5):776-789
  239. Slieker RC, Donnelly LA, Akalestou E, Lopez-Noriega L, Melhem R, Güneş A, Abou Azar F, Efanov A, Georgiadou E, Muniangi-Muhitu H, Sheikh M, Giordano GN, Åkerlund M, Ahlqvist E, Ali A, Banasik K, Brunak S, Barovic M, Bouland GA, Burdet F, Canouil M, Dragan I, Elders PJM, Fernandez C, Festa A, Fitipaldi H, Froguel P, Gudmundsdottir V, Gudnason V, Gerl MJ, van der Heijden AA, Jennings LL, Hansen MK, Kim M, Leclerc I, Klose C, Kuznetsov D, Mansour Aly D, Mehl F, Marek D, Melander O, Niknejad A, Ottosson F, Pavo I, Duffin K, Syed SK, Shaw JL, Cabrera O, Pullen TJ, Simons K, Solimena M, Suvitaival T, Wretlind A, Rossing P, Lyssenko V, Legido Quigley C, Groop L, Thorens B, Franks PW, Lim GE, Estall J, Ibberson M, Beulens JWJ, 't Hart LM, Pearson ER, Rutter GA. Identification of biomarkers for glycaemic deterioration in type 2 diabetes. Nat Commun 2023;14(1):2533
  240. Sola M, Rendon-Angel A, Rojo Martinez V, Sgrignani J, Magrin C, Piovesana E, Cavalli A, Paganetti P, Papin S. Tau protein binds to the P53 E3 ubiquitin ligase MDM2. Sci Rep 2023;13(1):10208
  241. Soneson C, Bendel AM, Diss G, Stadler MB. mutscan-a flexible R package for efficient end-to-end analysis of multiplexed assays of variant effect data. Genome Biol 2023;24(1):132
  242. Sonrel A, Luetge A, Soneson C, Mallona I, Germain PL, Knyazev S, Gilis J, Gerber R, Seurinck R, Paul D, Sonder E, Crowell HL, Fanaswala I, Al-Ajami A, Heidari E, Schmeing S, Milosavljevic S, Saeys Y, Mangul S, Robinson MD. Meta-analysis of (single-cell method) benchmarks reveals the need for extensibility and interoperability. Genome Biol 2023;24(1):119
  243. Sousa da Mota B, Rubinacci S, Cruz Dávalos DI, G Amorim CE, Sikora M, Johannsen NN, Szmyt MH, Włodarczak P, Szczepanek A, Przybyła MM, Schroeder H, Allentoft ME, Willerslev E, Malaspinas AS, Delaneau O. Imputation of ancient human genomes. Nat Commun 2023;14(1):3660
  244. Spriano F, Aresu L, Cascione L, Risi G, Arribas AJ, Napoli S, Forster-Gross N, Bachmann F, Engelhardt M, Lane H, Bertoni F. The microtubule-targeted agent lisavanbulin (BAL101553) shows anti-tumor activity in lymphoma models. Am J Cancer Res 2023;13(5):2076-2086
  245. Steiner M, Pingel M, Falquet L, Giffard B, Griesser M, Leyer I, Preda C, Uzman D, Bacher S, Reineke A. Local conditions matter: Minimal and variable effects of soil disturbance on microbial communities and functions in European vineyards. PLoS One 2023;18(1):e0280516
  246. Stetka J, Usart M, Kubovcakova L, Rai S, Rao TN, Sutter J, Hao-Shen H, Dirnhofer S, Geier F, Bader MS, Passweg JR, Manolova V, Dürrenberger F, Ahmed N, Schroeder T, Ganz T, Nemeth E, Silvestri L, Nai A, Camaschella C, Skoda RC. Iron is a modifier of the phenotypes of JAK2-mutant myeloproliferative neoplasms. Blood 2023;141(17):2127-2140
  247. Strässle M, Grossmann J, Eppenberger P, Faas A, Jerkovic I, Floris J, Öhrström L, Akgül G, Aldakak L, Rühli F, Bender N, Staub K. Short-termed changes in quantitative ultrasound estimated bone density among young men in an 18-weeks follow-up during their basic training for the Swiss Armed Forces. PeerJ 2023;11:e15205
  248. Suppinger S, Zinner M, Aizarani N, Lukonin I, Ortiz R, Azzi C, Stadler MB, Vianello S, Palla G, Kohler H, Mayran A, Lutolf MP, Liberali P. Multimodal characterization of murine gastruloid development. Cell Stem Cell 2023;30(6):867-884.e11
  249. Szklarczyk D, Kirsch R, Koutrouli M, Nastou K, Mehryary F, Hachilif R, Gable AL, Fang T, Doncheva NT, Pyysalo S, Bork P, Jensen LJ, von Mering C. The STRING database in 2023: protein-protein association networks and functional enrichment analyses for any sequenced genome of interest. Nucleic Acids Res 2023;51(d1):D638-D646
  250. Tadros DM, Eggenschwiler S, Racle J, Gfeller D. The MHC Motif Atlas: a database of MHC binding specificities and ligands. Nucleic Acids Res 2023;51(d1):D428-D437
  251. Theissinger K, Fernandes C, Formenti G, Bista I, Berg PR, Bleidorn C, Bombarely A, Crottini A, Gallo GR, Godoy JA, Jentoft S, Malukiewicz J, Mouton A, Oomen RA, Paez S, Palsbøll PJ, Pampoulie C, Ruiz-López MJ, Secomandi S, Svardal H, Theofanopoulou C, de Vries J, Waldvogel AM, Zhang G, Jarvis ED, Bálint M, Ciofi C, Waterhouse RM, Mazzoni CJ, Höglund J, European Reference Genome Atlas Consortium. How genomics can help biodiversity conservation. Trends Genet 2023;39(7):545-559
  252. Theorell A, Stelling J. Assumptions on decision making and environment can yield multiple steady states in microbial community models. BMC Bioinformatics 2023;24(suppl 1):262
  253. Thirant C, Peltier A, Durand S, Kramdi A, Louis-Brennetot C, Pierre-Eugène C, Gautier M, Costa A, Grelier A, Zaïdi S, Gruel N, Jimenez I, Lapouble E, Pierron G, Sitbon D, Brisse HJ, Gauthier A, Fréneaux P, Grossetête S, Baudrin LG, Raynal V, Baulande S, Bellini A, Bhalshankar J, Carcaboso AM, Geoerger B, Rohrer H, Surdez D, Boeva V, Schleiermacher G, Delattre O, Janoueix-Lerosey I. Reversible transitions between noradrenergic and mesenchymal tumor identities define cell plasticity in neuroblastoma. Nat Commun 2023;14(1):2575
  254. Tichet M, Wullschleger S, Chryplewicz A, Fournier N, Marcone R, Kauzlaric A, Homicsko K, Deak LC, Umaña P, Klein C, Hanahan D. Bispecific PD1-IL2v and anti-PD-L1 break tumor immunity resistance by enhancing stem-like tumor-reactive CD8+ T cells and reprogramming macrophages. Immunity 2023;56(1):162-179.e6
  255. Timasheva Y, Lepik K, Liska O, Papp B, Kutalik Z. Widespread natural selection on metabolite levels in humans 2023
  256. Timin G, Milinkovitch MC. High-resolution confocal and light-sheet imaging of collagen 3D network architecture in very large samples. iScience 2023;26(4):106452
  257. Tofilo M, Voronova N, Nigmatullina L, Kuznetsova E, Timonina V, Efimenko B, Turgunkhujaev O, Avdeichik S, Ansar M, Popadin K, Kirillova A, Mazunin I. Live Birth of a Healthy Child in a Couple with Identical mtDNA Carrying a Pathogenic c.471_477delTTTAAAAinsG Variant in the MOCS2 Gene. Genes (Basel) 2023;14(3):720
  258. Togninalli M, Wang X, Kucera T, Shrestha S, Juliana P, Mondal S, Pinto F, Govindan V, Crespo-Herrera L, Huerta-Espino J, Singh RP, Borgwardt K, Poland J. Multi-modal deep learning improves grain yield prediction in wheat breeding by fusing genomics and phenomics. Bioinformatics 2023;39(6):btad336
  259. Tomasoni M, Beyeler MJ, Vela SO, Mounier N, Porcu E, Corre T, Krefl D, Button AL, Abouzeid H, Lazaros K, Bochud M, Schlingemann R, Bergin C, Bergmann S. Genome-wide Association Studies of Retinal Vessel Tortuosity Identify Numerous Novel Loci Revealing Genes and Pathways Associated With Ocular and Cardiometabolic Diseases. Ophthalmol Sci 2023;3(3):100288
  260. Touré H, Galindo LA, Lagune M, Glatigny S, Waterhouse RM, Guénal I, Herrmann JL, Girard-Misguich F, Szuplewski S. Mycobacterium abscessus resists the innate cellular response by surviving cell lysis of infected phagocytes. PLoS Pathog 2023;19(3):e1011257
  261. Touré V, Krauss P, Gnodtke K, Buchhorn J, Unni D, Horki P, Raisaro JL, Kalt K, Teixeira D, Crameri K, Österle S. FAIRification of health-related data using semantic web technologies in the Swiss Personalized Health Network. Sci Data 2023;10(1):127
  262. Trefny MP, Kirchhammer N, Auf der Maur P, Natoli M, Schmid D, Germann M, Fernandez Rodriguez L, Herzig P, Lötscher J, Akrami M, Stinchcombe JC, Stanczak MA, Zingg A, Buchi M, Roux J, Marone R, Don L, Lardinois D, Wiese M, Jeker LT, Bentires-Alj M, Rossy J, Thommen DS, Griffiths GM, Läubli H, Hess C, Zippelius A. Deletion of SNX9 alleviates CD8 T cell exhaustion for effective cellular cancer immunotherapy. Nat Commun 2023;14(1):86
  263. Trofimova O, Latypova A, DiDomenicantonio G, Lutti A, de Lange AG, Kliegel M, Stringhini S, Marques-Vidal P, Vaucher J, Vollenweider P, Strippoli MF, Preisig M, Kherif F, Draganski B. Topography of associations between cardiovascular risk factors and myelin loss in the ageing human brain. Commun Biol 2023;6(1):392
  264. Tzika AC, Ullate-Agote A, Zakany S, Kummrow M, Milinkovitch MC. Somitic positional information guides self-organized patterning of snake scales. Sci Adv 2023;9(24):eadf8834
  265. Valentin JDP, Altenried S, Varadarajan AR, Ahrens CH, Schreiber F, Webb JS, van der Mei HC, Ren Q. Identification of Potential Antimicrobial Targets of Pseudomonas aeruginosa Biofilms through a Novel Screening Approach. Microbiol Spectr 2023:e0309922
  266. Vallat B, Tauriello G, Bienert S, Haas J, Webb BM, Žídek A, Zheng W, Peisach E, Piehl DW, Anischanka I, Sillitoe I, Tolchard J, Varadi M, Baker D, Orengo C, Zhang Y, Hoch JC, Kurisu G, Patwardhan A, Velankar S, Burley SK, Sali A, Schwede T, Berman HM, Westbrook JD. ModelCIF: An Extension of PDBx/mmCIF Data Representation for Computed Structure Models. J Mol Biol 2023;435(14):168021
  267. Vannetti SM, Wynne JW, English C, Huynh C, Knüsel R, de Sales-Ribeiro C, Widmer M, Delalay G, Schmidt-Posthaus H. Amoeba species colonizing the gills of rainbow trout (Oncorhynchus mykiss) in Swiss aquaculture. J Fish Dis 2023
  268. Veglia AJ, Bistolas KSI, Voolstra CR, Hume BCC, Ruscheweyh HJ, Planes S, Allemand D, Boissin E, Wincker P, Poulain J, Moulin C, Bourdin G, Iwankow G, Romac S, Agostini S, Banaigs B, Boss E, Bowler C, de Vargas C, Douville E, Flores M, Forcioli D, Furla P, Galand PE, Gilson E, Lombard F, Pesant S, Reynaud S, Sunagawa S, Thomas OP, Troublé R, Zoccola D, Correa AMS, Vega Thurber RL. Endogenous viral elements reveal associations between a non-retroviral RNA virus and symbiotic dinoflagellate genomes. Commun Biol 2023;6(1):566
  269. Vora J, Navelkar R, Vijay-Shanker K, Edwards N, Martinez K, Ding X, Wang T, Su P, Ross K, Lisacek F, Hayes C, Kahsay R, Ranzinger R, Tiemeyer M, Mazumder R. The Glycan Structure Dictionary-a dictionary describing commonly used glycan structure terms. Glycobiology 2023;33(5):354-357
  270. Waespe N, Mlakar SJ, Dupanloup I, Rezgui MA, Bittencourt H, Krajinovic M, Kuehni CE, Nava T, Ansari M. A novel integrative multi-omics approach to unravel the genetic determinants of rare diseases with application in sinusoidal obstruction syndrome. PLoS One 2023;18(4):e0281892
  271. Wagner A. Evolvability-enhancing mutations in the fitness landscapes of an RNA and a protein. Nat Commun 2023;14(1):3624
  272. Wang X, Peischl S, Heckel G. Demographic history and genomic consequences of 10,000 generations of isolation in a wild mammal. Curr Biol 2023;33(10):2051-2062.e4
  273. Wegmann D, Eckel R. Human evolution: When admixture met selection. Curr Biol 2023;33(7):R259-R261
  274. Weiler P, Van den Berge K, Street K, Tiberi S. A Guide to Trajectory Inference and RNA Velocity. Methods Mol Biol 2023;2584:269-292
  275. Welte T, Goulois A, Stadler MB, Hess D, Soneson C, Neagu A, Azzi C, Wisser MJ, Seebacher J, Schmidt I, Estoppey D, Nigsch F, Reece-Hoyes J, Hoepfner D, Großhans H. Convergence of multiple RNA-silencing pathways on GW182/TNRC6. Mol Cell 2023:S1097-2765(23)00423-9
  276. Welter D, Juty N, Rocca-Serra P, Xu F, Henderson D, Gu W, Strubel J, Giessmann RT, Emam I, Gadiya Y, Abbassi-Daloii T, Alharbi E, Gray AJG, Courtot M, Gribbon P, Ioannidis V, Reilly DS, Lynch N, Boiten JW, Satagopam V, Goble C, Sansone SA, Burdett T. FAIR in action - a flexible framework to guide FAIRification. Sci Data 2023;10(1):291
  277. Wicky A, Gatta R, Latifyan S, Micheli R, Gerard C, Pradervand S, Michielin O, Cuendet MA. Interactive process mining of cancer treatment sequences with melanoma real-world data. Front Oncol 2023;13:1043683
  278. Winstanley-Zarach P, Rot G, Kuba S, Smagul A, Peffers MJ, Tew SR. Analysis of RNA Polyadenylation in Healthy and Osteoarthritic Human Articular Cartilage. Int J Mol Sci 2023;24(7):6611
  279. Wischnewski V, Maas RR, Aruffo PG, Soukup K, Galletti G, Kornete M, Galland S, Fournier N, Lilja J, Wirapati P, Lourenco J, Scarpa A, Daniel RT, Hottinger AF, Brouland JP, Losurdo A, Voulaz E, Alloisio M, Hegi ME, Lugli E, Joyce JA. Phenotypic diversity of T cells in human primary and metastatic brain tumors revealed by multiomic interrogation. Nat Cancer 2023;4(6):908-924
  280. Wissel D, Rowson D, Boeva V. Systematic comparison of multi-omics survival models reveals a widespread lack of noise resistance. Cell Rep Methods 2023;3(4):100461
  281. Wolfe AJ, Rademacher DJ, Mores CR, Evans RJ, Overholt T, Halverson T, Limeira R, Matthews C, Badlani G, Brubaker L, Walker SJ. Detection of Bacteria in Bladder Mucosa of Adult Females. J Urol 2023;209(5):937-949
  282. Wolski WE, Nanni P, Grossmann J, d'Errico M, Schlapbach R, Panse C. prolfqua: A Comprehensive R-Package for Proteomics Differential Expression Analysis. J Proteome Res 2023;22(4):1092-1104
  283. Xu ZM, Naret O, Fellay J. G2GSnake: A Snakemake workflow for host-pathogen genomic association studies 2023
  284. Xu ZM, Zwyer M, Brites D, Hiza H, Sasamalo M, Reinhard M, Doetsch A, Borrell S, Naret O, Rüeger S, Lawless D, Isihaka F, Temba H, Maroa T, Naftari R, Beisel C, Hella J, Reither K, Portevin D, Gagneux S, Fellay J. Genome-to-genome analysis reveals associations between human and mycobacterial genetic variation in tuberculosis patients from Tanzania 2023
  285. Yang L, Sadler MC, Altman RB. Genetic association studies using disease liabilities from deep neural networks 2023
  286. Yousaf H, Rehmat S, Jameel M, Ibrahim R, Hashmi SN, Makhdoom EUH, Iwaszkiewicz J, Saadi SM, Tariq M, Baig SM, Toft M, Fatima A, Iqbal Z. A homozygous founder variant in PDE2A causes paroxysmal dyskinesia with intellectual disability. Clin Genet 2023
  287. Zamariolli M, Auwerx C, Sadler MC, van der Graaf A, Lepik K, Schoeler T, Moysés-Oliveira M, Dantas AG, Melaragno MI, Kutalik Z. The impact of 22q11.2 copy-number variants on human traits in the general population. Am J Hum Genet 2023;110(2):300-313
  288. Zaru R, Orchard S, UniProt Consortium. UniProt Tools: BLAST, Align, Peptide Search, and ID Mapping. Curr Protoc 2023;3(3):e697
  289. Ziegler A, Öner A, Quadflieg G, Betschart RO, Thiéry A, Babel H, Mwambi HG, Neumeyer H, Mackschin S, Hintz S, Mann M, Dittrich H, Schmidt C. Cost-effectiveness of a telemonitoring programme in patients with cardiovascular diseases compared with standard of care. Heart 2023:heartjnl-2023-322518
  290. Ziyani C, Delaneau O, Ribeiro DM. Multimodal single cell analysis infers widespread enhancer co-activity in a lymphoblastoid cell line. Commun Biol 2023;6(1):563
  291. Zwyer M, Rutaihwa LK, Windels E, Hella J, Menardo F, Sasamalo M, Sommer G, Schmülling L, Borrell S, Reinhard M, Dötsch A, Hiza H, Stritt C, Sikalengo G, Fenner L, De Jong BC, Kato-Maeda M, Jugheli L, Ernst JD, Niemann S, Jeljeli L, Ballif M, Egger M, Rakotosamimanana N, Yeboah-Manu D, Asare P, Malla B, Dou HY, Zetola N, Wilkinson RJ, Cox H, Carter EJ, Gnokoro J, Yotebieng M, Gotuzzo E, Abimiku A, Avihingsanon A, Xu ZM, Fellay J, Portevin D, Reither K, Stadler T, Gagneux S, Brites D. Back-to-Africa introductions of Mycobacterium tuberculosis as the main cause of tuberculosis in Dar es Salaam, Tanzania. PLoS Pathog 2023;19(4):e1010893

Browse other years

2022 2021 2020