ATGACGGATGCCGGAATTGGCATGACGGATGCCGGAATTGGCACATAACAAGTACTGCTCGGTCCTTAAGCTGTATTGCACCATATGACGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
Peer-reviewed papers and preprints by our members

Scientific publications 2025

Bioinformatics has become essential to convert biological questions into answers. Discover the breadth of our scientists' work and contributions through their publications. 

 

Source: Europe PMC, latest update: 01.06.25

Discover the SIB Remarkable Outputs 2024

The Remarkable Outputs are selected by the Award Committee to provide the community with the yearly achievements by SIB Scientists that are particularly deserving attention. From new algorithms to detect disease-related genes to exploring the origins of sexual reproduction, discover this shortlist of publications, software tools, databases and outreach projects.

  1. Aoki-Kinoshita KF, Lisacek F, Mazumder R, Ranzinger R, Tiemeyer M, Yamada I, Packer NH. Meeting report of the GlySpace Alliance and GaLSIC symposium. Glycobiology 2025;35(5):cwaf019
  2. Aparo A, Avesani S, Parmigiani L, Napoli S, Bertoni F, Bonnici V, Cascione L, Giugno R. EasyCircR: Detection and reconstruction of circular RNAs post-transcriptional regulatory interaction networks. Comput Biol Med 2025;188:109846
  3. Balajti M, Kandhari R, Jurič B, Zavolan M, Kanitz A. HTSinfer: inferring metadata from bulk Illumina RNA-Seq libraries. Bioinformatics 2025;41(3):btaf076
  4. Barbera MC, Guarrera L, Re Cecconi AD, Cassanmagnago GA, Vallerga A, Lunardi M, Checchi F, Di Rito L, Romeo M, Mapelli SN, Schoser B, Generozov EV, Molecular Genetics Group, Jansen R, de Geus EJC, Penninx B, van Dongen J, Craparotta I, Piccirillo R, Ahmetov II, Bolis M. Increased ectodysplasin-A2-receptor EDA2R is a ubiquitous hallmark of aging and mediates parainflammatory responses. Nat Commun 2025;16(1):1898
  5. Bastian FB, Cammarata AB, Carsanaro S, Detering H, Huang WT, Joye S, Niknejad A, Nyamari M, Mendes de Farias T, Moretti S, Tzivanopoulou M, Wollbrett J, Robinson-Rechavi M. Bgee in 2024: focus on curated single-cell RNA-seq datasets, and query tools. Nucleic Acids Res 2025;53(d1):D878-D885
  6. Bayer F, Roncador M, Moffa G, Morita K, Takahashi K, Beerenwinkel N, Kuipers J. Network-based clustering unveils interconnected landscapes of genomic and clinical features across myeloid malignancies. Nat Commun 2025;16(1):4043
  7. Bağcı C, Nuhamunada M, Goyat H, Ladanyi C, Sehnal L, Blin K, Kautsar SA, Tagirdzhanov A, Gurevich A, Mantri S, von Mering C, Udwary D, Medema MH, Weber T, Ziemert N. BGC Atlas: a web resource for exploring the global chemical diversity encoded in bacterial genomes. Nucleic Acids Res 2025;53(d1):D618-D624
  8. Bejarano L, Lourenco J, Kauzlaric A, Lamprou E, Costa CF, Galland S, Maas RR, Guerrero Aruffo P, Fournier N, Brouland JP, Hottinger AF, Daniel RT, Hegi ME, Joyce JA. Single-cell atlas of endothelial and mural cells across primary and metastatic brain tumors. Immunity 2025;58(4):1015-1032.e6
  9. Beyer D, Vaccarin C, Schmid JV, Deberle LM, Deupi X, Schibli R, Müller C. Design and Preclinical Evaluation of Novel uPAR-Targeting Radiopeptides Modified with an Albumin-Binding Entity. Mol Pharm 2025
  10. Blum M, Andreeva A, Florentino LC, Chuguransky SR, Grego T, Hobbs E, Pinto BL, Orr A, Paysan-Lafosse T, Ponamareva I, Salazar GA, Bordin N, Bork P, Bridge A, Colwell L, Gough J, Haft DH, Letunic I, Llinares-López F, Marchler-Bauer A, Meng-Papaxanthos L, Mi H, Natale DA, Orengo CA, Pandurangan AP, Piovesan D, Rivoire C, Sigrist CJA, Thanki N, Thibaud-Nissen F, Thomas PD, Tosatto SCE, Wu CH, Bateman A. InterPro: the protein sequence classification resource in 2025. Nucleic Acids Res 2025;53(d1):D444-D456
  11. Bolleman J, Emonet V, Altenhoff A, Bairoch A, Blatter MC, Bridge A, Duvaud S, Gasteiger E, Kuznetsov D, Moretti S, Michel PA, Morgat A, Pagni M, Redaschi N, Zahn-Zabal M, de Farias TM, Sima AC. A large collection of bioinformatics question-query pairs over federated knowledge graphs: methodology and applications.Gigascience 2025;14:giaf045
  12. Bramon Mora B, Lindsay H, Thiébaut A, Stuart KD, Gottardo R. tagtango: an application to compare single-cell annotations. Bioinformatics 2025;41(2):btaf012
  13. Brasier N, Niederberger C, Zanella M, Othman A, Schlapbach R, Kunz L, Dittmann A, Reeve K, Prummer M, Goldhahn J. The molecular signature of heat stress in sweat reveals non-invasive biomarker candidates for health monitoring. Commun Biol 2025;8(1):650
  14. Bulliard M, Pinjusic K, Iacobucci L, Schmuziger C, Fournier N, Constam DB. Kallikrein-8 mediates furin-independent Activin-A precursor processing to stimulate tumor growth in melanoma. Nat Commun 2025;16(1):2354
  15. Chamberlain JD, Ackermann D, Bochud M, Booth T, Chapatte L, Corley J, Cox SR, Harris SE, Kinnaer C, Juster RP, Locatelli I, Nanchen D, Ponte B, Pruijm M, Pradervand S, Shiels PG, Stringhini S, Nusslé S, Gonseth-Nusslé S. Development and validation of an epigenetic signature of allostatic load. Biosci Rep2025;45(4):BSR20241663
  16. Chen Z, Tsui JL, Cai J, Su S, Viboud C, du Plessis L, Lemey P, Kraemer MUG, Yu H. Disruption of seasonal influenza circulation and evolution during the 2009 H1N1 and COVID-19 pandemics in Southeastern Asia. Nat Commun 2025;16(1):475
  17. Cherrak Y, Younes AA, Perez-Molphe-Montoya E, Maurer L, Yilmaz K, Enz U, Zeder C, Kiefer P, Christen P, Gül E, Vorholt JA, von Mering C, Hardt WD. Neutrophil recruitment during intestinal inflammation primes Salmonella elimination by commensal E. coli in a context-dependent manner. Cell Host Microbe 2025;33(3):358-372.e4
  18. Chiva C, Olivella R, Staes A, Mendes Maia T, Panse C, Stejskal K, Douché T, Lombard B, Schuhmann A, Loew D, Mechtler K, Matondo M, Rettel M, Helm D, Impens F, Devos S, Shevchenko A, Nanni P, Sabidó E. A Multiyear Longitudinal Harmonization Study of Quality Controls in Mass Spectrometry Proteomics Core Facilities.J Proteome Res 2025;24(2):397-409
  19. Conforti S, Rossi Orts P, Tamminen M, Julian TR. High-Throughput Multiplex Detection of Antibiotic-Resistant Genes and Virulence Factors in Escherichia coli Using Digital Multiplex Ligation Assay. J Mol Diagn 2025;27(6):511-524
  20. Cooper RL, Milinkovitch MC. In vivo sonic hedgehog pathway antagonism temporarily results in ancestral proto-feather-like structures in the chicken. PLoS Biol 2025;23(3):e3003061
  21. Cui H, Tejada-Lapuerta A, Brbić M, Saez-Rodriguez J, Cristea S, Goodarzi H, Lotfollahi M, Theis FJ, Wang B. Towards multimodal foundation models in molecular cell biology. Nature 2025;640(8059):623-633
  22. Das SG, Mungan M, Krug J. Epistasis-mediated compensatory evolution in a fitness landscape with adaptational tradeoffs. Proc Natl Acad Sci U S A 2025;122(15):e2422520122
  23. Dennstädt F, Hastings J, Putora PM, Schmerder M, Cihoric N. Implementing large language models in healthcare while balancing control, collaboration, costs and security. NPJ Digit Med 2025;8(1):143
  24. Di Giacomo AM, Subudhi S, Vos W, Andreatta M, Carmona S, McTavish W, Seliger B, Ibrahim R, Lahn M, Smith M, Eggermont A, Fox BA, Maio M. Perspectives on the role of "-Omics" in predicting response to immunotherapy. Eur J Cancer 2025;220:115393
  25. Ding W, Silvestro D, Onstein RE, Wu M, Zhou Z, Xing Y. The stepwise rise of angiosperm-dominated terrestrial ecosystems. Biol Rev Camb Philos Soc 2025
  26. Dmitrijeva M, Ruscheweyh HJ, Feer L, Li K, Miravet-Verde S, Sintsova A, Mende DR, Zeller G, Sunagawa S. The mOTUs online database provides web-accessible genomic context to taxonomic profiling of microbial communities. Nucleic Acids Res 2025;53(d1):D797-D805
  27. Dondi A, Borgsmüller N, Ferreira PF, Haas BJ, Jacob F, Heinzelmann-Schwarz V, Tumor Profiler Consortium, Beerenwinkel N. De novo detection of somatic variants in high-quality long-read single-cell RNA sequencing data. Genome Res 2025;35(4):900-913
  28. Dong Y, Saglietti C, Bayard Q, Espin Perez A, Carpentier S, Buszta D, Tissot S, Dubois R, Kamburov A, Kang S, Haignere C, Sarkis R, Andre S, Alexandre Gaveta M, Lopez Lastra S, Piazzon N, Santos R, von Loga K, Hoffmann C, Coukos G, Peters S, Soumelis V, Durand EY, de Leval L, Gottardo R, Homicsko K, Madissoon E.Transcriptome analysis of archived tumors by Visium, GeoMx DSP, and Chromium reveals patient heterogeneity. Nat Commun 2025;16(1):4400
  29. Drnevich J, Tan FJ, Almeida-Silva F, Castelo R, Culhane AC, Davis S, Doyle MA, Geistlinger L, Ghazi AR, Holmes S, Lahti L, Mahmoud A, Nishida K, Ramos M, Rue-Albrecht K, Shih DJH, Gatto L, Soneson C. Learning and teaching biological data science in the Bioconductor community. PLoS Comput Biol 2025;21(4):e1012925
  30. Droghetti R, Fuchs P, Iuliani I, Firmano V, Tallarico G, Calabrese L, Grilli J, Sclavi B, Ciandrini L, Cosentino Lagomarsino M. Incoherent feedback from coupled amino acids and ribosome pools generates damped oscillations in growing E. coli. Nat Commun 2025;16(1):3063
  31. Emons M, Blanquart F, Lehtinen S. The evolution of antibiotic resistance in Europe, 1998-2019. PLoS Pathog 2025;21(4):e1012945
  32. Feuermann M, Mi H, Gaudet P, Muruganujan A, Lewis SE, Ebert D, Mushayahama T, Gene Ontology Consortium, Thomas PD. A compendium of human gene functions derived from evolutionary modelling. Nature 2025;640(8057):146-154
  33. Fu J, Zanotelli VRT, Howald C, Chammartin N, Kolpakov I, Xenarios I, Froese DS, Wollscheid B, Pedrioli PGA, Goetze S. A Multi-Omics Framework for Decoding Disease Mechanisms: Insights from Methylmalonic Aciduria. Mol Cell Proteomics 2025:100998
  34. Fuqua T, Wagner A. The latent cis-regulatory potential of mobile DNA in Escherichia coli. Nat Commun 2025;16(1):4740
  35. Gaboriau T, Tobias JA, Silvestro D, Salamin N. Exploring the Macroevolutionary Signature of Asymmetric Inheritance at Speciation. Syst Biol 2025;74(2):267-281
  36. Gaio D, Tackmann J, Perez-Molphe-Montoya E, Näpflin N, Patsch D, Malfertheiner L, von Mering C. Enhanced semantic classification of microbiome sample origins using Large Language Models (LLMs) 2025
  37. Gayet-Ageron A, Ben Messaoud K, Richards M, Jaksic C, Gobeill J, Liyanapathirana J, Mottin L, Naderi N, Ruch P, Mariot Z, Calmy A, Friedman J, Leibovici L, Schroter S. Gender and geographical bias in the editorial decision-making process of biomedical journals: a case-control study. BMJ Evid Based Med 2025;30(3):149-162
  38. Geng A, Brenig RG, Roux J, Lütge M, Cheng HW, Flint EE, Lussier POG, Meier MA, Pop OT, Künzler-Heule P, Matter MS, Wendon J, McPhail MJW, Soysal S, Semela D, Heim M, Weston CJ, Ludewig B, Bernsmeier C. Circulating monocytes upregulate CD52 and sustain innate immune function in cirrhosis unless acute decompensation emerges. J Hepatol 2025:S0168-8278(24)02818-6
  39. German J, Cordioli M, Tozzo V, Urbut S, Arumäe K, Smit RAJ, Lee J, Li JH, Janucik A, Ding Y, Akinkuolie A, Heyne HO, Eoli A, Saad C, Al-Sarraj Y, Abdel-Latif R, Mohammed S, Hail MA, Barry A, Wang Z, Cajuso T, Corbetta A, Natarajan P, Ripatti S, Philippakis A, Szczerbinski L, Pasaniuc B, Kutalik Z, Mbarek H, Loos RJF, Vainik U, Ganna A. Association between plausible genetic factors and weight loss from GLP1-RA and bariatric surgery. Nat Med 2025
  40. Glaus AN, Brechet M, Swinnen G, Lebeigle L, Iwaszkiewicz J, Ambrosini G, Julca I, Zhang J, Roberts R, Iseli C, Guex N, Jiménez-Gómez J, Glover N, Martin GB, Strickler S, Soyk S. Repairing a deleterious domestication variant in a floral regulator gene of tomato by base editing. Nat Genet 2025;57(1):231-241
  41. Godbold G, Proescher J, Gaudet P. New and revised gene ontology biological process terms describe multiorganism interactions critical for understanding microbial pathogenesis and sequences of concern. J Biomed Semantics 2025;16(1):4
  42. Hablützel L, Mullon C, Schmid M. The evolution of local adaptation in long-lived species. Evolution 2025:qpaf031
  43. Hinz FB, Masters MR, Nguyen JT, Mahmoud AH, Lill MA. Accelerated Hydration Site Localization and Thermodynamic Profiling. J Chem Inf Model 2025;65(6):2794-2805
  44. Hodcroft EB, Wohlfender MS, Neher RA, Riou J, Althaus CL. Estimating Re and overdispersion in secondary cases from the size of identical sequence clusters of SARS-CoV-2. PLoS Comput Biol 2025;21(4):e1012960
  45. Huang YH, Escalona HE, Sun YF, Zhang PF, Du XY, Gong SR, Tang XF, Liang YS, Yang D, Chen PT, Yang HY, Chen ML, Hüttel B, Hlinka O, Wang X, Meusemann K, Ślipiński A, Zwick A, Waterhouse RM, Misof B, Niehuis O, Li HS, Pang H. Molecular evolution of dietary shifts in ladybird beetles (Coleoptera: Coccinellidae): from fungivory to carnivory and herbivory. BMC Biol 2025;23(1):67
  46. Huang YN, Munteanu V, Love MI, Ronkowski CF, Deshpande D, Wong-Beringer A, Corbett-Detig R, Dimian M, Moore JH, Garmire LX, Reddy TBK, Butte AJ, Robinson MD, Eskin E, Abedalthagafi MS, Mangul S. Perceptual and technical barriers in sharing and formatting metadata accompanying omics studies. Cell Genom2025;5(5):100845
  47. Höcketstaller K, Marti IA, Bank C, Yilmaz B, Becker J. Antimicrobial Resistance in Wildlife: Associations with Environmental Factors and Taxonomic Variation. Environ Res 2025:121968
  48. Iber D, Mederacke M, Vetter R. Coordination of nephrogenesis with branching of the urinary collecting system, the vasculature and the nervous system. Curr Top Dev Biol 2025;163:45-82
  49. Ito J, Strange A, Liu W, Joas G, Lytras S, Genotype to Phenotype Japan (G2P-Japan) Consortium, Sato K. A protein language model for exploring viral fitness landscapes. Nat Commun 2025;16(1):4236
  50. Jamy M, Huber T, Antoine T, Ruscheweyh H, Paoli L, Pelletier E, Delmont TO, Burki F. New deep-branching environmental plastid genomes on the algal tree of life 2025
  51. Jelcic I, Naghavian R, Fanaswala I, Macnair W, Esposito C, Calini D, Han Y, Marti Z, Raposo C, Sarabia Del Castillo J, Oldrati P, Erny D, Kana V, Zheleznyakova G, Al Nimer F, Tackenberg B, Reichen I, Khademi M, Piehl F, Robinson MD, Jelcic I, Sospedra M, Pelkmans L, Malhotra D, Reynolds R, Jagodic M, Martin R. T-bet+ CXCR3+ B cells drive hyperreactive B-T cell interactions in multiple sclerosis. Cell Rep Med 2025;6(3):102027
  52. Julou T, Gervais T, de Groot D, van Nimwegen E. Growth rate controls the sensitivity of gene regulatory circuits. Sci Adv 2025;11(17):eadu9279
  53. Karakulak T, Zajac N, Bolck HA, Bratus-Neuenschwander A, Zhang Q, Qi W, Basu D, Oltra TC, Rehrauer H, von Mering C, Moch H, Kahraman A. Heterogeneous and novel transcript expression in single cells of patient-derived clear cell renal cell carcinoma organoids. Genome Res 2025;35(4):698-711
  54. Kim KM, Lizano AMD, Toonen RJ, Ravago-Gotanco R. Genomic Divergence of Sympatric Lineages Within <i>Stichopus</i> cf. <i>horrens</i> (Echinodermata: Stichopodidae): Insights on Reproductive Isolation Inferred From SNP Markers. Ecol Evol 2025;15(4):e71283
  55. Kirchhoffer OA, Quirós-Guerrero L, Nitschke J, Nothias LF, Burdet F, Marcourt L, Hanna N, Mehl F, David B, Grondin A, Queiroz EF, Pagni M, Soldati T, Wolfender JL. Prioritization of novel anti-infective stilbene derivatives by combining metabolomic data organization and a stringent 3R-infection model in a knowledge graph.RSC Adv 2025;15(17):13010-13030
  56. Komarov N, Fritsch C, Maier GL, Bues J, Biočanin M, Avalos CB, Dodero A, Kwon JY, Deplancke B, Sprecher SG. Food hardness preference reveals multisensory contributions of fly larval gustatory organs in behaviour and physiology. PLoS Biol 2025;23(1):e3002730
  57. Koptekin D, Yapar E, Vural KB, Sağlıcan E, Altınışık NE, Malaspinas AS, Alkan C, Somel M. Pre-processing of paleogenomes: mitigating reference bias and postmortem damage in ancient genome data. Genome Biol 2025;26(1):6
  58. Koutsovoulos GD, Poullet M, Elashry A, Kozlowski DKL, Sallet E, Da Rocha M, Perfus-Barbeoch L, Martin-Jimenez C, Frey JE, Ahrens CH, Kiewnick S, Danchin EGJ. Retraction Note: Genome assembly and annotation of Meloidogyne enterolobii, an emerging parthenogenetic root-knot nematode. Sci Data 2025;12(1):183
  59. Kraemer MUG, Tsui JL, Chang SY, Lytras S, Khurana MP, Vanderslott S, Bajaj S, Scheidwasser N, Curran-Sebastian JL, Semenova E, Zhang M, Unwin HJT, Watson OJ, Mills C, Dasgupta A, Ferretti L, Scarpino SV, Koua E, Morgan O, Tegally H, Paquet U, Moutsianas L, Fraser C, Ferguson NM, Topol EJ, Duchêne DA, Stadler T, Kingori P, Parker MJ, Dominici F, Shadbolt N, Suchard MA, Ratmann O, Flaxman S, Holmes EC, Gomez-Rodriguez M, Schölkopf B, Donnelly CA, Pybus OG, Cauchemez S, Bhatt S. Artificial intelligence for modelling infectious disease epidemics. Nature 2025;638(8051):623-635
  60. Kraft A, Kirschner MB, Orlowski V, Ronner M, Bodmer C, Boeva V, Opitz I, Meerang M. Exploring RNA cargo in extracellular vesicles for pleural mesothelioma detection. BMC Cancer 2025;25(1):212
  61. Kuipers J, Tuncel MA, Ferreira PF, Jahn K, Beerenwinkel N. Single-cell copy number calling and event history reconstruction. Bioinformatics 2025;41(3):btaf072
  62. Kushida T, de Farias TM, Sima AC, Dessimoz C, Chiba H, Bastian FB, Masuya H. Federated SPARQL query performance evaluation for exploring disease model mouse: combining gene expression, orthology, and disease knowledge graphs. BMC Med Inform Decis Mak 2025;25(suppl 1):189
  63. Kweon H, Burik CAP, Ning Y, Ahlskog R, Xia C, Abner E, Bao Y, Bhatta L, Faquih TO, de Feijter M, Fisher P, Gelemanović A, Giannelis A, Hottenga JJ, Khalili B, Lee Y, Li-Gao R, Masso J, Myhre R, Palviainen T, Rietveld CA, Teumer A, Verweij RM, Willoughby EA, Agerbo E, Bergmann S, Boomsma DI, Børglum AD, Brumpton BM, Davies NM, Esko T, Gordon SD, Homuth G, Ikram MA, Johannesson M, Kaprio J, Kidd MP, Kutalik Z, Kwong ASF, Lee JJ, Luik AI, Magnus P, Marques-Vidal P, Martin NG, Mook-Kanamori DO, Mortensen PB, Oskarsson S, Pedersen EM, Polašek O, Rosendaal FR, Smart MC, Snieder H, van der Most PJ, Vollenweider P, Völzke H, Willemsen G, Beauchamp JP, DiPrete TA, Linnér RK, Lu Q, Morris TT, Okbay A, Harden KP, Abdellaoui A, Hill WD, de Vlaming R, Benjamin DJ, Koellinger PD. Associations between common genetic variants and income provide insights about the socio-economic health gradient. Nat Hum Behav 2025;9(4):794-805
  64. Laman Trip DS, van Oostrum M, Memon D, Frommelt F, Baptista D, Panneerselvam K, Bradley G, Licata L, Hermjakob H, Orchard S, Trynka G, McDonagh EM, Fossati A, Aebersold R, Gstaiger M, Wollscheid B, Beltrao P. A tissue-specific atlas of protein-protein associations enables prioritization of candidate disease genes.Nat Biotechnol 2025
  65. Landi M, Carluccio AV, Shah T, Niazi A, Stavolone L, Falquet L, Gisel A, Bongcam-Rudloff E. Genome-wide comparison reveals large structural variants in cassava landraces. BMC Genomics 2025;26(1):362
  66. Lecointre M, Guillot J, Marcone R, Ozdoganlar D, Cayatte M, Jaensson Gyllenbäck E, Liberg D, Fournier N, Homicsko K, Hanahan D. HPV16-Expressing Tumors Release Multiple IL-1 Ligands to Orchestrate Systemic Immunosuppression Whose Disruption Enables Efficacy of a Therapeutic Vaccine. Cancer Discov 2025:OF1-OF26
  67. Leota J, Presby DM, Le F, Czeisler MÉ, Mascaro L, Capodilupo ER, Wiley JF, Drummond SPA, Rajaratnam SMW, Facer-Childs ER. Dose-response relationship between evening exercise and sleep. Nat Commun 2025;16(1):3297
  68. Lisacek F, Schnider B, Imberty A. Tools for structural lectinomics: From structures to lectomes. BBA Adv 2025;7:100154
  69. Lütge M, Kurz L, Stanossek Y, Meili S, Cheng HW, De Martin A, Brandstadter J, Maillard I, Robinson MD, Stoeckli SJ, Pikor NB, Onder L, Ludewig B. Fibroblastic reticular cells form reactive myeloid cell niches in human lymph nodes. Sci Immunol 2025;10(107):eads6820
  70. Majidian S, Nevers Y, Yazdizadeh Kharrazi A, Warwick Vesztrocy A, Pascarelli S, Moi D, Glover N, Altenhoff AM, Dessimoz C. Orthology inference at scale with FastOMA. Nat Methods 2025;22(2):269-272
  71. Malekpour SA, Kalirad A, Majidian S. Inferring the Selective History of CNVs Using a Maximum Likelihood Model. Genome Biol Evol 2025;17(3):evaf050
  72. Man A, Knüsel L, Graf J, Lali R, Le A, Di Scipio M, Mohammadi-Shemirani P, Chong M, Pigeyre M, Kutalik Z, Paré G. Identification of effect modifiers using a stratified Mendelian randomization algorithmic framework. Eur J Epidemiol 2025
  73. Maresca DC, La Civita E, Romano B, Ambrosio MR, Somma F, Wyss T, Rocco B, Rubino V, Cari L, Krebs P, Rodriguez-Calero A, Ferro M, Trabanelli S, Jandus C, Crocetto F, Ianaro A, Terracciano D, Ercolano G. Circulating innate lymphoid cells are dysregulated in patients with prostate cancer. Cell Mol Biol Lett 2025;30(1):48
  74. Marquez J, Cuendet MA, Caino-Lores S, Estrada T, Deelman E, Weinstein H, Taufer M. Increasing the Efficiency of Ensemble Molecular Dynamics Simulations with Termination of Unproductive Trajectories Identified at Runtime. J Phys Chem A 2025;129(9):2317-2324
  75. Massara M, Ballabio M, Dolfi B, Morad G, Wischnewski V, Lamprou E, Lourenco J, Claudinot S, Gallart-Ayala H, Méndez RS, Kauzlaric A, Fournier N, Damania AV, Wong MC, Ivanisevic J, Ajami NJ, Wargo JA, Joyce JA. The bacterial microbiome modulates the initiation of brain metastasis by impacting the gut-to-brain axis.iScience 2025;28(2):111874
  76. McLeod D, Bank C, Gandon S. A multilocus perspective on the evolutionary dynamics of multistrain pathogens Proc Natl Acad Sci U S A 2025;121(42)
  77. Meier CS, Pagni M, Richard S, Mühlethaler K, Hauser PM. Selective expression of <i>Pneumocystis</i> antigens in different patients during a suspected outbreak of <i>Pneumocystis</i> pneumonia. mBio 2025;16(5):e0069225
  78. Miglino N, Toussaint NC, Ring A, Bonilla X, Tusup M, Gosztonyi B, Mehra T, Gut G, Jacob F, Chevrier S, Lehmann KV, Casanova R, Jacobs A, Sivapatham S, Boos L, Rahimzadeh P, Schuerch M, Sobottka B, Chicherova N, Yu S, Wegmann R, Mena J, Milani ES, Goetze S, Esposito C, Sarabia Del Castillo J, Frei AL, Nowak M, Irmisch A, Kuipers J, Baciu-Drăgan MA, Ferreira PF, Singer F, Bertolini A, Prummer M, Lischetti U, Tumor Profiler Consortium, Aebersold R, Bacac M, Maass G, Moch H, Weller M, Theocharides APA, Manz MG, Beerenwinkel N, Beisel C, Pelkmans L, Snijder B, Wollscheid B, Heinzelmann V, Bodenmiller B, Levesque MP, Koelzer VH, Rätsch G, Dummer R, Wicki A. Feasibility of multiomics tumor profiling for guiding treatment of melanoma. Nat Med 2025
  79. Mihajlovic L, Iyengar BR, Baier F, Barbier I, Iwaszkiewicz J, Zoete V, Wagner A, Schaerli Y. A direct experimental test of Ohno's hypothesis. Elife 2025;13:RP97216
  80. Mizrahi O, Corley M, Feldman O, Fröhlking T, Sun L, Ziesel A, Antczak M, Bernetti M, Elhajjajy SI, Huang W, Nguyen GG, Park SS, Perez Martell RI, Trinity L, Xu K, Zok T, Bussi G, Jabbari H, Orenstein Y, Aviran S, Meyer MM, Yeo G. Evaluation of novel computational methods to identify RNA-binding protein footprints from structural data. RNA 2025:rna.080215.124
  81. Modesto M, Scarafile D, Vásquez A, Pukall R, Neumann-Schaal M, Pascarelli S, Sgorbati B, Ancora M, Cammà C, Mattarelli P, Olofsson TC. Phylogenetic characterization of Bifidobacterium kimbladii sp. nov., a novel species from the honey stomach of the honeybee Apis mellifera. Syst Appl Microbiol 2025;48(1):126579
  82. Molari M, Shaw LP, Neher RA. Quantifying the Evolutionary Dynamics of Structure and Content in Closely Related E. coli Genomes. Mol Biol Evol 2025;42(1):msae272
  83. Molodenskiy D, Maurer VJ, Yu D, Chojnowski G, Bienert S, Tauriello G, Gilep K, Schwede T, Kosinski J. AlphaPulldown2-a general pipeline for high-throughput structural modeling. Bioinformatics 2025;41(3):btaf115
  84. Moon Y, Herrmann CJ, Mironov A, Zavolan M. PolyASite v3.0: a multi-species atlas of polyadenylation sites inferred from single-cell RNA-sequencing data. Nucleic Acids Res 2025;53(d1):D197-D204
  85. Mottin L, Gobeill J, Pathirana JL, Naderi N, Mottaz A, Messaoud KB, Gayet-Ageron A, Ruch P. Manuscript Classification to Support the Analysis of Biases in Publication Opportunities. Stud Health Technol Inform 2025;327:828-832
  86. Muench P, Fiumara M, Southern N, Coda D, Aschenbrenner S, Correia B, Gräff J, Niopek D, Mathony J. A modular toolbox for the optogenetic deactivation of transcription. Nucleic Acids Res 2025;53(3):gkae1237
  87. Mühle J, Alenfelder J, Rodrigues MJ, Jürgenliemke L, Guixà-González R, Grätz L, Andres F, Bacchin A, Hennig M, Schihada H, Crüsemann M, König GM, Schertler G, Kostenis E, Deupi X. Cyclic peptide inhibitors function as molecular glues to stabilize Gq/11 heterotrimers. Proc Natl Acad Sci U S A 2025;122(19):e2418398122
  88. Ordon J, Logemann E, Maier LP, Lee T, Dahms E, Oosterwijk A, Flores-Uribe J, Miyauchi S, Paoli L, Stolze SC, Nakagami H, Felix G, Garrido-Oter R, Ma KW, Schulze-Lefert P. Conserved immunomodulation and variation in host association by Xanthomonadales commensals in Arabidopsis root microbiota. Nat Plants2025;11(3):612-631
  89. Pitton M, Valente LG, Oberhaensli S, Gözel B, Jakob SM, Sendi P, Fürholz M, Cameron DR, Que YA. Targeting Chronic Biofilm Infections With Patient-derived Phages: An In Vitro and Ex Vivo Proof-of-concept Study in Patients With Left Ventricular Assist Devices. Open Forum Infect Dis 2025;12(4):ofaf158
  90. Pla-Díaz M, Akgül G, Molak M, du Plessis L, Panagiotopoulou H, Doan K, Bogdanowicz W, Dąbrowski P, Oziembłowski M, Kwiatkowska B, Szczurowski J, Grzelak J, Arora N, Majander K, González-Candelas F, Schuenemann VJ. Insights into Treponema pallidum genomics from modern and ancient genomes using a novel mapping strategy. BMC Biol 2025;23(1):7
  91. Prieto-Baños S, Layton KKS. Tracing the evolution of key traits in dorid nudibranchs. PLoS One 2025;20(4):e0317704
  92. Pétremand R, Chiffelle J, Bobisse S, Perez MAS, Schmidt J, Arnaud M, Barras D, Lozano-Rabella M, Genolet R, Sauvage C, Saugy D, Michel A, Huguenin-Bergenat AL, Capt C, Moore JS, De Vito C, Labidi-Galy SI, Kandalaft LE, Dangaj Laniti D, Bassani-Sternberg M, Oliveira G, Wu CJ, Coukos G, Zoete V, Harari A. Author Correction: Identification of clinically relevant T cell receptors for personalized T cell therapy using combinatorial algorithms. Nat Biotechnol 2025;43(3):445
  93. Qin Q, Popic V, Wienand K, Yu H, White E, Khorgade A, Shin A, Georgescu C, Campbell CD, Dondi A, Beerenwinkel N, Vazquez F, Al'Khafaji AM, Haas BJ. Accurate fusion transcript identification from long- and short-read isoform sequencing at bulk or single-cell resolution. Genome Res 2025;35(4):967-986
  94. Riccio C, Jansen ML, Thalén F, Koliopanos G, Link V, Ziegler A. Assessment of the functionality and usability of open-source rare variant analysis pipelines. Brief Bioinform 2025;26(1):bbaf044
  95. Rosenberg NA, Stadler T, Steel M. "A mathematical theory of evolution": phylogenetic models dating back 100 years. Philos Trans R Soc Lond B Biol Sci 2025;380(1919):20230297
  96. Royet K, Kergoat L, Lutz S, Oriol C, Parisot N, Schori C, Ahrens CH, Rodrigue A, Gueguen E. High-Throughput Tn-Seq Screens Identify Both Known and Novel Pseudomonas putida KT2440 Genes Involved in Metal Tolerance. Environ Microbiol 2025;27(5):e70095
  97. Sadler MC, Apostolov A, Cevallos C, Auwerx C, Ribeiro DM, Altman RB, Kutalik Z. Leveraging large-scale biobank EHRs to enhance pharmacogenetics of cardiometabolic disease medications. Nat Commun 2025;16(1):2913
  98. Saelens W, Pushkarev O, Deplancke B. ChromatinHD connects single-cell DNA accessibility and conformation to gene expression through scale-adaptive machine learning. Nat Commun 2025;16(1):317
  99. Sajic T, Vizovišek M, Arni S, Ciuffa R, Mehnert M, Lenglet S, Weder W, Gallart-Ayala H, Ivanisevic J, Buljan M, Thomas A, Hillinger S, Aebersold R. Depletion-dependent activity-based protein profiling using SWATH/DIA-MS detects serine hydrolase lipid remodeling in lung adenocarcinoma progression. Nat Commun2025;16(1):4889
  100. Samarasinghe KW, Kotlyar M, Vallet SD, Hayes C, Naba A, Jurisica I, Lisacek F, Ricard-Blum S. MatrixDB 2024: an increased coverage of extracellular matrix interactions, a new Network Explorer and a new web interface. Nucleic Acids Res 2025;53(d1):D1677-D1682
  101. Schoeler T, Pingault JB, Kutalik Z. Combining cross-sectional and longitudinal genomic approaches to identify determinants of cognitive and physical decline. Nat Commun 2025;16(1):4524
  102. Schubert C, Nguyen BD, Sichert A, Näpflin N, Sintsova A, Feer L, Näf J, Daniel BBJ, Steiger Y, von Mering C, Sauer U, Hardt WD. Monosaccharides drive Salmonella gut colonization in a context-dependent or -independent manner. Nat Commun 2025;16(1):1735
  103. Schuhknecht L, Ortmayr K, Jänes J, Bläsi M, Panoussis E, Bors S, Dorčáková T, Fuhrer T, Beltrao P, Zampieri M. A human metabolic map of pharmacological perturbations reveals drug modes of action. Nat Biotechnol 2025
  104. Servajean R, Alexandre A, Bitbol AF. Impact of complex spatial population structure on early and long-term adaptation in rugged fitness landscapes. Evolution 2025:qpaf025
  105. Settelmeier J, Goetze S, Boshart J, Fu J, Khoo A, Steiner SN, Gesell M, Hammer J, Schüffler PJ, Salimova D, Pedrioli PGA, Wollscheid B. MultiOmicsAgent: Guided Extreme Gradient-Boosted Decision Trees-Based Approaches for Biomarker-Candidate Discovery in Multiomics Data. J Proteome Res 2025
  106. Sharma N, Das SG, Krug J, Traulsen A. Graph-structured populations elucidate the role of deleterious mutations in long-term evolution. Nat Commun 2025;16(1):2355
  107. Silverstein RA, Kim N, Kroell AS, Walton RT, Delano J, Butcher RM, Pacesa M, Smith BK, Christie KA, Ha LL, Meis RJ, Clark AB, Spinner AD, Lazzarotto CR, Li Y, Matsubara A, Urbina EO, Dahl GA, Correia BE, Marks DS, Tsai SQ, Pinello L, De Ravin SS, Liu Q, Kleinstiver BP. Custom CRISPR-Cas9 PAM variants via scalable engineering and machine learning. Nature 2025
  108. Skribbe M, Soneson C, Stadler MB, Schwaiger M, Suma Sreechakram VN, Iesmantavicius V, Hess D, Moreno EPF, Braun S, Seebacher J, Smallwood SA, Bühler M. A comprehensive Schizosaccharomyces pombe atlas of physical transcription factor interactions with proteins and chromatin. Mol Cell 2025;85(7):1426-1444.e8
  109. Soneson C, Shepherd L, Ramos M, Rue-Albrecht K, Rainer J, Pagès H, Carey VJ. Eleven quick tips for writing a Bioconductor package. PLoS Comput Biol 2025;21(3):e1012856
  110. Strütt S, Excoffier L, Peischl S. A generalized structured coalescent for purifying selection without recombination. Genetics 2025;229(4):iyaf013
  111. Su L, Ding L, Williams PH, Liu Y, Wang R, Dai X, Zhao S, Fu H, Zhao X, Wang Q, Li Y, Sang H, Waterhouse RM, Zhai Y, Sun C. Genetic differentiation and adaptive evolution of buff-tailed bumblebees in Asia. Insect Sci 2025
  112. Sun M, Garnier L, Chevalier R, Roumain M, Wang C, Angelillo J, Montorfani J, Pick R, Brighouse D, Fournier N, Tarussio D, Tissot S, Lobaccaro JM, Petrova TV, Jandus C, Speiser DE, Kopf M, Pot C, Scheiermann C, Homicsko K, Muccioli GG, Garg AD, Hugues S. Lymphatic-derived oxysterols promote anti-tumor immunity and response to immunotherapy in melanoma. Nat Commun 2025;16(1):1217
  113. Sun Y, Silvestro D, Mathes GH, van der Heijden MGA, Müller-Schärer H. Eco-Evolutionary Dynamics of Plant-Soil Feedbacks Explain the Spread Potential of a Plant Invader Under Climate Warming and Biocontrol Herbivory. Glob Chang Biol 2025;31(3):e70110
  114. Szklarczyk D, Nastou K, Koutrouli M, Kirsch R, Mehryary F, Hachilif R, Hu D, Peluso ME, Huang Q, Fang T, Doncheva NT, Pyysalo S, Bork P, Jensen LJ, von Mering C. The STRING database in 2025: protein networks with directionality of regulation. Nucleic Acids Res 2025;53(d1):D730-D737
  115. Tadros DM, Racle J, Gfeller D. Predicting MHC-I ligands across alleles and species: how far can we go? Genome Med 2025;17(1):25
  116. Tarantelli C, Kayali O, Civanelli E, Cascione L, Mensah AA, Folloni C, Arribas AJ, Rinaldi A, Cmiljanovic V, Mondello P, Bertoni F. Targeting of PIM Kinases Shows Single Agent Efficacy and Synergizes With BCL2 Inhibitors in Diffuse Large B Cell Lymphoma of the ABC Subtype. Hematol Oncol 2025;43(2):e70055
  117. Tauriello G, Waterhouse AM, Haas J, Behringer D, Bienert S, Garello T, Schwede T. ModelArchive: A Deposition Database for Computational Macromolecular Structural Models. J Mol Biol 2025:168996
  118. Tegenfeldt F, Kuznetsov D, Manni M, Berkeley M, Zdobnov EM, Kriventseva EV. OrthoDB and BUSCO update: annotation of orthologs with wider sampling of genomes. Nucleic Acids Res 2025;53(d1):D516-D522
  119. Tognetti M, Chatterjee L, Beaton N, Sklodowski K, Bruderer R, Reiter L, Messner CB. Serum proteomics reveals survival-associated biomarkers in pancreatic cancer patients treated with chemoimmunotherapy. iScience 2025;28(4):112230
  120. Topaloudis A, Cumer T, Lavanchy E, Ducrest AL, Simon C, Machado AP, Paposhvili N, Roulin A, Goudet J. The recombination landscape of the barn owl, from families to populations. Genetics 2025;229(1):1-50
  121. Touré V, Unni D, Krauss P, Abdelwahed A, Buchhorn J, Hinderling L, Geiger TR, Österle S. The SPHN Schema Forge - transform healthcare semantics from human-readable to machine-readable by leveraging semantic web technologies. J Biomed Semantics 2025;16(1):9
  122. Triscott J, Lehner M, Benjak A, Reist M, Emerling BM, Ng CKY, de Brot S, Rubin MA. Loss of PI5P4Kα Slows the Progression of a Pten Mutant Basal Cell Model of Prostate Cancer. Mol Cancer Res 2025;23(1):33-45
  123. Truman K, Vaughan TG, Gavryushkin A, Gavryushkina AS. The Fossilized Birth-Death Model Is Identifiable. Syst Biol 2025;74(1):112-123
  124. Träger LK, Degen M, Pereira J, Durairaj J, Teixeira RD, Hiller S, Huguenin-Dezot N. Structural basis for cooperative ssDNA binding by bacteriophage protein filament P12. Nucleic Acids Res 2025;53(5):gkaf132
  125. Tzeng SF, Yu YR, Park J, von Renesse J, Hsiao HW, Hsu CH, Garnica J, Chen J, Chiu LT, Santol J, Chen TY, Chung PH, Kandalaft LE, Starlinger P, Hsieh RC, Yu MC, Hsiao PW, Carmona SJ, Chen HK, Meng Z, Lin YH, Zhou J, Tsai CH, Ho PC. PLT012, a Humanized CD36-Blocking Antibody, Is Effective for Unleashing Antitumor Immunity Against Liver Cancer and Liver Metastasis. Cancer Discov 2025:OF1-OF21
  126. Usart M, Kimmerlin Q, Stetka J, Stoll C, Rai S, Almeida Fonseca T, Karjalainen R, Hao-Shen H, Roux J, El Taher A, Lynch D, Makukhin N, Ciulli A, Skoda RC. Loss of Socs2 improves molecular responses to IFNα in a mouse model of myeloproliferative neoplasms driven by JAK2-V617F. Leukemia 2025;39(4):876-887
  127. Vale PD, Fotsing EDB, Mucyo SJP, Abwage WD, Dibakou SE, N'Goran KP, Sop T, van der Hoek Y, Heinicke S, Kulik L, Kone I, Kuehl H. Retraction Note: Great ape abundance and per capita carbon storage in their habitats. BMC Ecol Evol 2025;25(1):29
  128. Van Hecke M, Beerenwinkel N, Lootens T, Fostier J, Raedt R, Marchal K. ELLIPSIS: robust quantification of splicing in scRNA-seq. Bioinformatics 2025;41(2):btaf028
  129. Vande Moortele T, Verschaffelt P, Huang Q, Doncheva NT, Holstein T, Jachmann C, Dawyndt P, Martens L, Mesuere B, Van Den Bossche T. PathwayPilot: A User-Friendly Tool for Visualizing and Navigating Metabolic Pathways. Mol Cell Proteomics 2025;24(3):100918
  130. Windels EM, Valenzuela Agüí C, de Jong BC, Meehan CJ, Loiseau C, Goig GA, Zwyer M, Borrell S, Brites D, Gagneux S, Stadler T. Onset of infectiousness explains differences in transmissibility across Mycobacterium tuberculosis lineages. Epidemics 2025;51:100821
  131. Wolski WE, Grossmann J, Schwarz L, Leary P, Türker C, Nanni P, Schlapbach R, Panse C. <i>prolfquapp</i> ─ A User-Friendly Command-Line Tool Simplifying Differential Expression Analysis in Quantitative Proteomics. J Proteome Res 2025;24(2):955-965
  132. Xia F, Verbiest MA, Lundström O, Sonay TB, Baudis M, Anisimova M. Multicancer analyses of short tandem repeat variations reveal shared gene regulatory mechanisms. Brief Bioinform 2025;26(3):bbaf219
  133. Xie S, Kutalik Z, Thomas A, Perrais M, Vaucher J, Marques-Vidal P. Urinary Copper Is Associated with Dyslipidemia, and This Association Is Mediated by Inflammation. Biol Trace Elem Res 2025
  134. Yang L, Sadler MC, Altman RB. Genetic association studies using disease liabilities from deep neural networks. Am J Hum Genet 2025;112(3):675-692
  135. Zancolli G, Modica MV, Puillandre N, Kantor Y, Barua A, Campli G, Robinson-Rechavi M. Redistribution of Ancestral Functions Underlies the Evolution of Venom Production in Marine Predatory Snails. Mol Biol Evol 2025;42(5):msaf095
  136. Zdouc MM, Blin K, Louwen NLL, Navarro J, Loureiro C, Bader CD, Bailey CB, Barra L, Booth TJ, Bozhüyük KAJ, Cediel-Becerra JDD, Charlop-Powers Z, Chevrette MG, Chooi YH, D'Agostino PM, de Rond T, Del Pup E, Duncan KR, Gu W, Hanif N, Helfrich EJN, Jenner M, Katsuyama Y, Korenskaia A, Krug D, Libis V, Lund GA, Mantri S, Morgan KD, Owen C, Phan CS, Philmus B, Reitz ZL, Robinson SL, Singh KS, Teufel R, Tong Y, Tugizimana F, Ulanova D, Winter JM, Aguilar C, Akiyama DY, Al-Salihi SAA, Alanjary M, Alberti F, Aleti G, Alharthi SA, Rojo MYA, Arishi AA, Augustijn HE, Avalon NE, Avelar-Rivas JA, Axt KK, Barbieri HB, Barbosa JCJ, Barboza Segato LG, Barrett SE, Baunach M, Beemelmanns C, Beqaj D, Berger T, Bernaldo-Agüero J, Bettenbühl SM, Bielinski VA, Biermann F, Borges RM, Borriss R, Breitenbach M, Bretscher KM, Brigham MW, Buedenbender L, Bulcock BW, Cano-Prieto C, Capela J, Carrion VJ, Carter RS, Castelo-Branco R, Castro-Falcón G, Chagas FO, Charria-Girón E, Chaudhri AA, Chaudhry V, Choi H, Choi Y, Choupannejad R, Chromy J, Donahey MSC, Collemare J, Connolly JA, Creamer KE, Crüsemann M, Cruz AA, Cumsille A, Dallery JF, Damas-Ramos LC, Damiani T, de Kruijff M, Martín BD, Sala GD, Dillen J, Doering DT, Dommaraju SR, Durusu S, Egbert S, Ellerhorst M, Faussurier B, Fetter A, Feuermann M, Fewer DP, Foldi J, Frediansyah A, Garza EA, Gavriilidou A, Gentile A, Gerke J, Gerstmans H, Gomez-Escribano JP, González-Salazar LA, Grayson NE, Greco C, Gomez JEG, Guerra S, Flores SG, Gurevich A, Gutiérrez-García K, Hart L, Haslinger K, He B, Hebra T, Hemmann JL, Hindra H, Höing L, Holland DC, Holme JE, Horch T, Hrab P, Hu J, Huynh TH, Hwang JY, Iacovelli R, Iftime D, Iorio M, Jayachandran S, Jeong E, Jing J, Jung JJ, Kakumu Y, Kalkreuter E, Kang KB, Kang S, Kim W, Kim GJ, Kim H, Kim HU, Klapper M, Koetsier RA, Kollten C, Kovács ÁT, Kriukova Y, Kubach N, Kunjapur AM, Kushnareva AK, Kust A, Lamber J, Larralde M, Larsen NJ, Launay AP, Le NT, Lebeer S, Lee BT, Lee K, Lev KL, Li SM, Li YX, Licona-Cassani C, Lien A, Liu J, Lopez JAV, Machushynets NV, Macias MI, Mahmud T, Maleckis M, Martinez-Martinez AM, Mast Y, Maximo MF, McBride CM, McLellan RM, Bhatt KM, Melkonian C, Merrild A, Metsä-Ketelä M, Mitchell DA, Müller AV, Nguyen GS, Nguyen HT, Niedermeyer THJ, O'Hare JH, Ossowicki A, Ostash BO, Otani H, Padva L, Paliyal S, Pan X, Panghal M, Parade DS, Park J, Parra J, Rubio MP, Pham HT, Pidot SJ, Piel J, Pourmohsenin B, Rakhmanov M, Ramesh S, Rasmussen MH, Rego A, Reher R, Rice AJ, Rigolet A, Romero-Otero A, Rosas-Becerra LR, Rosiles PY, Rutz A, Ryu B, Sahadeo LA, Saldanha M, Salvi L, Sánchez-Carvajal E, Santos-Medellin C, Sbaraini N, Schoellhorn SM, Schumm C, Sehnal L, Selem N, Shah AD, Shishido TK, Sieber S, Silviani V, Singh G, Singh H, Sokolova N, Sonnenschein EC, Sosio M, Sowa ST, Steffen K, Stegmann E, Streiff AB, Strüder A, Surup F, Svenningsen T, Sweeney D, Szenei J, Tagirdzhanov A, Tan B, Tarnowski MJ, Terlouw BR, Rey T, Thome NU, Torres Ortega LR, Tørring T, Trindade M, Truman AW, Tvilum M, Udwary DW, Ulbricht C, Vader L, van Wezel GP, Walmsley M, Warnasinghe R, Weddeling HG, Weir ANM, Williams K, Williams SE, Witte TE, Rocca SMW, Yamada K, Yang D, Yang D, Yu J, Zhou Z, Ziemert N, Zimmer L, Zimmermann A, Zimmermann C, van der Hooft JJJ, Linington RG, Weber T, Medema MH. MIBiG 4.0: advancing biosynthetic gene cluster curation through global collaboration. Nucleic Acids Res2025;53(d1):D678-D690
  137. Zouaghi Y, Alpern D, Gardeux V, Russeil J, Deplancke B, Santoni F, Pitteloud N, Messina A. Transcriptomic profiling of murine GnRH neurons reveals developmental trajectories linked to human reproduction and infertility. Theranostics 2025;15(8):3673-3692
  138. Zwaans A, Seidel S, Manceau M, Stadler T. A Bayesian phylodynamic inference framework for single-cell CRISPR/Cas9 lineage tracing barcode data with dependent target sites. Philos Trans R Soc Lond B Biol Sci 2025;380(1919):20230318
  139. de Korne-Elenbaas J, Caduff L, Lison A, McLeod R, Pitton M, Gan C, Julian TR. Design, validation, and implementation of multiplex digital PCR assays for simultaneous quantification of multiple targets. Lett Appl Microbiol 2025;78(1):ovae137
  140. de Vries PLM, Baud D, Baggio S, Ceulemans M, Favre G, Gerbier E, Legardeur H, Maisonneuve E, Pena-Reyes C, Pomar L, Winterfeld U, Panchaud A. Enhancing perinatal health patient information through ChatGPT - An accuracy study. PEC Innov 2025;6:100381

Browse other years