ATGACGGATGCCGGAATTGGCATGACGGATGCCGGAATTGGCACATAACAAGTACTGCTCGGTCCTTAAGCTGTATTGCACCATATGACGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
Peer-reviewed papers and preprints by our members

Scientific publications 2025

Bioinformatics has become essential to convert biological questions into answers. Discover the breadth of our scientists' work and contributions through their publications. 

 

Source: Europe PMC, latest update: 01.04.25

Discover the SIB Remarkable Outputs 2024

The Remarkable Outputs are selected by the Award Committee to provide the community with the yearly achievements by SIB Scientists that are particularly deserving attention. From new algorithms to detect disease-related genes to exploring the origins of sexual reproduction, discover this shortlist of publications, software tools, databases and outreach projects.

  1. Aparo A, Avesani S, Parmigiani L, Napoli S, Bertoni F, Bonnici V, Cascione L, Giugno R. EasyCircR: Detection and reconstruction of circular RNAs post-transcriptional regulatory interaction networks. Comput Biol Med 2025;188:109846
  2. Balajti M, Kandhari R, Jurič B, Zavolan M, Kanitz A. HTSinfer: inferring metadata from bulk Illumina RNA-Seq libraries. Bioinformatics 2025;41(3):btaf076
  3. Barbera MC, Guarrera L, Re Cecconi AD, Cassanmagnago GA, Vallerga A, Lunardi M, Checchi F, Di Rito L, Romeo M, Mapelli SN, Schoser B, Generozov EV, Molecular Genetics Group, Jansen R, de Geus EJC, Penninx B, van Dongen J, Craparotta I, Piccirillo R, Ahmetov II, Bolis M. Increased ectodysplasin-A2-receptor EDA2R is a ubiquitous hallmark of aging and mediates parainflammatory responses. Nat Commun 2025;16(1):1898
  4. Bastian FB, Cammarata AB, Carsanaro S, Detering H, Huang WT, Joye S, Niknejad A, Nyamari M, Mendes de Farias T, Moretti S, Tzivanopoulou M, Wollbrett J, Robinson-Rechavi M. Bgee in 2024: focus on curated single-cell RNA-seq datasets, and query tools. Nucleic Acids Res 2025;53(d1):D878-D885
  5. Bağcı C, Nuhamunada M, Goyat H, Ladanyi C, Sehnal L, Blin K, Kautsar SA, Tagirdzhanov A, Gurevich A, Mantri S, von Mering C, Udwary D, Medema MH, Weber T, Ziemert N. BGC Atlas: a web resource for exploring the global chemical diversity encoded in bacterial genomes. Nucleic Acids Res 2025;53(d1):D618-D624
  6. Bejarano L, Lourenco J, Kauzlaric A, Lamprou E, Costa CF, Galland S, Maas RR, Guerrero Aruffo P, Fournier N, Brouland JP, Hottinger AF, Daniel RT, Hegi ME, Joyce JA. Single-cell atlas of endothelial and mural cells across primary and metastatic brain tumors. Immunity 2025:S1074-7613(25)00089-5
  7. Blum M, Andreeva A, Florentino LC, Chuguransky SR, Grego T, Hobbs E, Pinto BL, Orr A, Paysan-Lafosse T, Ponamareva I, Salazar GA, Bordin N, Bork P, Bridge A, Colwell L, Gough J, Haft DH, Letunic I, Llinares-López F, Marchler-Bauer A, Meng-Papaxanthos L, Mi H, Natale DA, Orengo CA, Pandurangan AP, Piovesan D, Rivoire C, Sigrist CJA, Thanki N, Thibaud-Nissen F, Thomas PD, Tosatto SCE, Wu CH, Bateman A. InterPro: the protein sequence classification resource in 2025. Nucleic Acids Res 2025;53(d1):D444-D456
  8. Bramon Mora B, Lindsay H, Thiébaut A, Stuart KD, Gottardo R. tagtango: an application to compare single-cell annotations. Bioinformatics 2025;41(2):btaf012
  9. Bulliard M, Pinjusic K, Iacobucci L, Schmuziger C, Fournier N, Constam DB. Kallikrein-8 mediates furin-independent Activin-A precursor processing to stimulate tumor growth in melanoma. Nat Commun 2025;16(1):2354
  10. Chamberlain JD, Ackermann D, Bochud M, Booth T, Chapatte L, Corley J, Cox SR, Harris SE, Kinnaer C, Juster RP, Locatelli I, Nanchen D, Ponte B, Pruijm M, Pradervand S, Shiels PG, Stringhini S, Nusslé S, Gonseth-Nusslé S. Development and validation of an epigenetic signature of allostatic load. Biosci Rep2025:BSR20241663
  11. Chen Z, Tsui JL, Cai J, Su S, Viboud C, du Plessis L, Lemey P, Kraemer MUG, Yu H. Disruption of seasonal influenza circulation and evolution during the 2009 H1N1 and COVID-19 pandemics in Southeastern Asia. Nat Commun 2025;16(1):475
  12. Cherrak Y, Younes AA, Perez-Molphe-Montoya E, Maurer L, Yilmaz K, Enz U, Zeder C, Kiefer P, Christen P, Gül E, Vorholt JA, von Mering C, Hardt WD. Neutrophil recruitment during intestinal inflammation primes Salmonella elimination by commensal E. coli in a context-dependent manner. Cell Host Microbe 2025;33(3):358-372.e4
  13. Chiva C, Olivella R, Staes A, Mendes Maia T, Panse C, Stejskal K, Douché T, Lombard B, Schuhmann A, Loew D, Mechtler K, Matondo M, Rettel M, Helm D, Impens F, Devos S, Shevchenko A, Nanni P, Sabidó E. A Multiyear Longitudinal Harmonization Study of Quality Controls in Mass Spectrometry Proteomics Core Facilities.J Proteome Res 2025;24(2):397-409
  14. Cooper RL, Milinkovitch MC. In vivo sonic hedgehog pathway antagonism temporarily results in ancestral proto-feather-like structures in the chicken. PLoS Biol 2025;23(3):e3003061
  15. Dennstädt F, Hastings J, Putora PM, Schmerder M, Cihoric N. Implementing large language models in healthcare while balancing control, collaboration, costs and security. NPJ Digit Med 2025;8(1):143
  16. Dmitrijeva M, Ruscheweyh HJ, Feer L, Li K, Miravet-Verde S, Sintsova A, Mende DR, Zeller G, Sunagawa S. The mOTUs online database provides web-accessible genomic context to taxonomic profiling of microbial communities. Nucleic Acids Res 2025;53(d1):D797-D805
  17. Dondi A, Borgsmüller N, Ferreira PF, Haas BJ, Jacob F, Heinzelmann-Schwarz V, Tumor Profiler Consortium, Beerenwinkel N. De novo detection of somatic variants in high-quality long-read single-cell RNA sequencing data. Genome Res 2025
  18. Feuermann M, Mi H, Gaudet P, Muruganujan A, Lewis SE, Ebert D, Mushayahama T, Gene Ontology Consortium, Thomas PD. A compendium of human gene functions derived from evolutionary modelling. Nature 2025
  19. Geng A, Brenig RG, Roux J, Lütge M, Cheng HW, Flint EE, Lussier POG, Meier MA, Pop OT, Künzler-Heule P, Matter MS, Wendon J, McPhail MJW, Soysal S, Semela D, Heim M, Weston CJ, Ludewig B, Bernsmeier C. Circulating monocytes upregulate CD52 and sustain innate immune function in cirrhosis unless acute decompensation emerges. J Hepatol 2025:S0168-8278(24)02818-6
  20. Glaus AN, Brechet M, Swinnen G, Lebeigle L, Iwaszkiewicz J, Ambrosini G, Julca I, Zhang J, Roberts R, Iseli C, Guex N, Jiménez-Gómez J, Glover N, Martin GB, Strickler S, Soyk S. Repairing a deleterious domestication variant in a floral regulator gene of tomato by base editing. Nat Genet 2025;57(1):231-241
  21. Godbold G, Proescher J, Gaudet P. New and revised gene ontology biological process terms describe multiorganism interactions critical for understanding microbial pathogenesis and sequences of concern. J Biomed Semantics 2025;16(1):4
  22. Hablützel L, Mullon C, Schmid M. The evolution of local adaptation in long-lived species. Evolution 2025:qpaf031
  23. Hinz FB, Masters MR, Nguyen JT, Mahmoud AH, Lill MA. Accelerated Hydration Site Localization and Thermodynamic Profiling. J Chem Inf Model 2025
  24. Huang YH, Escalona HE, Sun YF, Zhang PF, Du XY, Gong SR, Tang XF, Liang YS, Yang D, Chen PT, Yang HY, Chen ML, Hüttel B, Hlinka O, Wang X, Meusemann K, Ślipiński A, Zwick A, Waterhouse RM, Misof B, Niehuis O, Li HS, Pang H. Molecular evolution of dietary shifts in ladybird beetles (Coleoptera: Coccinellidae): from fungivory to carnivory and herbivory. BMC Biol 2025;23(1):67
  25. Jamy M, Huber T, Antoine T, Ruscheweyh H, Paoli L, Pelletier E, Delmont TO, Burki F. New deep-branching environmental plastid genomes on the algal tree of life 2025
  26. Jelcic I, Naghavian R, Fanaswala I, Macnair W, Esposito C, Calini D, Han Y, Marti Z, Raposo C, Sarabia Del Castillo J, Oldrati P, Erny D, Kana V, Zheleznyakova G, Al Nimer F, Tackenberg B, Reichen I, Khademi M, Piehl F, Robinson MD, Jelcic I, Sospedra M, Pelkmans L, Malhotra D, Reynolds R, Jagodic M, Martin R. T-bet+ CXCR3+ B cells drive hyperreactive B-T cell interactions in multiple sclerosis. Cell Rep Med 2025;6(3):102027
  27. Karakulak T, Zajac N, Bolck HA, Bratus-Neuenschwander A, Zhang Q, Qi W, Basu D, Oltra TC, Rehrauer H, von Mering C, Moch H, Kahraman A. Heterogeneous and novel transcript expression in single cells of patient-derived clear cell renal cell carcinoma organoids. Genome Res 2025
  28. Komarov N, Fritsch C, Maier GL, Bues J, Biočanin M, Avalos CB, Dodero A, Kwon JY, Deplancke B, Sprecher SG. Food hardness preference reveals multisensory contributions of fly larval gustatory organs in behaviour and physiology. PLoS Biol 2025;23(1):e3002730
  29. Koptekin D, Yapar E, Vural KB, Sağlıcan E, Altınışık NE, Malaspinas AS, Alkan C, Somel M. Pre-processing of paleogenomes: mitigating reference bias and postmortem damage in ancient genome data. Genome Biol 2025;26(1):6
  30. Koutsovoulos GD, Poullet M, Elashry A, Kozlowski DKL, Sallet E, Da Rocha M, Perfus-Barbeoch L, Martin-Jimenez C, Frey JE, Ahrens CH, Kiewnick S, Danchin EGJ. Retraction Note: Genome assembly and annotation of Meloidogyne enterolobii, an emerging parthenogenetic root-knot nematode. Sci Data 2025;12(1):183
  31. Kraemer MUG, Tsui JL, Chang SY, Lytras S, Khurana MP, Vanderslott S, Bajaj S, Scheidwasser N, Curran-Sebastian JL, Semenova E, Zhang M, Unwin HJT, Watson OJ, Mills C, Dasgupta A, Ferretti L, Scarpino SV, Koua E, Morgan O, Tegally H, Paquet U, Moutsianas L, Fraser C, Ferguson NM, Topol EJ, Duchêne DA, Stadler T, Kingori P, Parker MJ, Dominici F, Shadbolt N, Suchard MA, Ratmann O, Flaxman S, Holmes EC, Gomez-Rodriguez M, Schölkopf B, Donnelly CA, Pybus OG, Cauchemez S, Bhatt S. Artificial intelligence for modelling infectious disease epidemics. Nature 2025;638(8051):623-635
  32. Kraft A, Kirschner MB, Orlowski V, Ronner M, Bodmer C, Boeva V, Opitz I, Meerang M. Exploring RNA cargo in extracellular vesicles for pleural mesothelioma detection. BMC Cancer 2025;25(1):212
  33. Kuipers J, Tuncel MA, Ferreira PF, Jahn K, Beerenwinkel N. Single-cell copy number calling and event history reconstruction. Bioinformatics 2025;41(3):btaf072
  34. Kweon H, Burik CAP, Ning Y, Ahlskog R, Xia C, Abner E, Bao Y, Bhatta L, Faquih TO, de Feijter M, Fisher P, Gelemanović A, Giannelis A, Hottenga JJ, Khalili B, Lee Y, Li-Gao R, Masso J, Myhre R, Palviainen T, Rietveld CA, Teumer A, Verweij RM, Willoughby EA, Agerbo E, Bergmann S, Boomsma DI, Børglum AD, Brumpton BM, Davies NM, Esko T, Gordon SD, Homuth G, Ikram MA, Johannesson M, Kaprio J, Kidd MP, Kutalik Z, Kwong ASF, Lee JJ, Luik AI, Magnus P, Marques-Vidal P, Martin NG, Mook-Kanamori DO, Mortensen PB, Oskarsson S, Pedersen EM, Polašek O, Rosendaal FR, Smart MC, Snieder H, van der Most PJ, Vollenweider P, Völzke H, Willemsen G, Beauchamp JP, DiPrete TA, Linnér RK, Lu Q, Morris TT, Okbay A, Harden KP, Abdellaoui A, Hill WD, de Vlaming R, Benjamin DJ, Koellinger PD. Associations between common genetic variants and income provide insights about the socio-economic health gradient. Nat Hum Behav 2025
  35. Majidian S, Nevers Y, Yazdizadeh Kharrazi A, Warwick Vesztrocy A, Pascarelli S, Moi D, Glover N, Altenhoff AM, Dessimoz C. Orthology inference at scale with FastOMA. Nat Methods 2025;22(2):269-272
  36. Malekpour SA, Kalirad A, Majidian S. Inferring the selective history of CNVs using a maximum likelihood model. Genome Biol Evol 2025:evaf050
  37. Man A, Knüsel L, Graf J, Lali R, Le A, Di Scipio M, Mohammadi-Shemirani P, Chong M, Pigeyre M, Kutalik Z, Paré G. Identification of effect modifiers using a stratified Mendelian randomization algorithmic framework. Eur J Epidemiol 2025
  38. Marquez J, Cuendet MA, Caino-Lores S, Estrada T, Deelman E, Weinstein H, Taufer M. Increasing the Efficiency of Ensemble Molecular Dynamics Simulations with Termination of Unproductive Trajectories Identified at Runtime. J Phys Chem A 2025;129(9):2317-2324
  39. Massara M, Ballabio M, Dolfi B, Morad G, Wischnewski V, Lamprou E, Lourenco J, Claudinot S, Gallart-Ayala H, Méndez RS, Kauzlaric A, Fournier N, Damania AV, Wong MC, Ivanisevic J, Ajami NJ, Wargo JA, Joyce JA. The bacterial microbiome modulates the initiation of brain metastasis by impacting the gut-to-brain axis.iScience 2025;28(2):111874
  40. Modesto M, Scarafile D, Vásquez A, Pukall R, Neumann-Schaal M, Pascarelli S, Sgorbati B, Ancora M, Cammà C, Mattarelli P, Olofsson TC. Phylogenetic characterization of Bifidobacterium kimbladii sp. nov., a novel species from the honey stomach of the honeybee Apis mellifera. Syst Appl Microbiol 2025;48(1):126579
  41. Molari M, Shaw LP, Neher RA. Quantifying the Evolutionary Dynamics of Structure and Content in Closely Related E. coli Genomes. Mol Biol Evol 2025;42(1):msae272
  42. Molodenskiy D, Maurer VJ, Yu D, Chojnowski G, Bienert S, Tauriello G, Gilep K, Schwede T, Kosinski J. AlphaPulldown2-a general pipeline for high-throughput structural modeling. Bioinformatics 2025:btaf115
  43. Moon Y, Herrmann CJ, Mironov A, Zavolan M. PolyASite v3.0: a multi-species atlas of polyadenylation sites inferred from single-cell RNA-sequencing data. Nucleic Acids Res 2025;53(d1):D197-D204
  44. Muench P, Fiumara M, Southern N, Coda D, Aschenbrenner S, Correia B, Gräff J, Niopek D, Mathony J. A modular toolbox for the optogenetic deactivation of transcription. Nucleic Acids Res 2025;53(3):gkae1237
  45. Ordon J, Logemann E, Maier LP, Lee T, Dahms E, Oosterwijk A, Flores-Uribe J, Miyauchi S, Paoli L, Stolze SC, Nakagami H, Felix G, Garrido-Oter R, Ma KW, Schulze-Lefert P. Conserved immunomodulation and variation in host association by Xanthomonadales commensals in Arabidopsis root microbiota. Nat Plants2025;11(3):612-631
  46. Pla-Díaz M, Akgül G, Molak M, du Plessis L, Panagiotopoulou H, Doan K, Bogdanowicz W, Dąbrowski P, Oziembłowski M, Kwiatkowska B, Szczurowski J, Grzelak J, Arora N, Majander K, González-Candelas F, Schuenemann VJ. Insights into Treponema pallidum genomics from modern and ancient genomes using a novel mapping strategy. BMC Biol 2025;23(1):7
  47. Pétremand R, Chiffelle J, Bobisse S, Perez MAS, Schmidt J, Arnaud M, Barras D, Lozano-Rabella M, Genolet R, Sauvage C, Saugy D, Michel A, Huguenin-Bergenat AL, Capt C, Moore JS, De Vito C, Labidi-Galy SI, Kandalaft LE, Dangaj Laniti D, Bassani-Sternberg M, Oliveira G, Wu CJ, Coukos G, Zoete V, Harari A. Author Correction: Identification of clinically relevant T cell receptors for personalized T cell therapy using combinatorial algorithms. Nat Biotechnol 2025;43(3):445
  48. Qin Q, Popic V, Wienand K, Yu H, White E, Khorgade A, Shin A, Georgescu C, Campbell CD, Dondi A, Beerenwinkel N, Vazquez F, Al'Khafaji AM, Haas BJ. Accurate fusion transcript identification from long- and short-read isoform sequencing at bulk or single-cell resolution. Genome Res 2025
  49. Rosenberg NA, Stadler T, Steel M. "A mathematical theory of evolution": phylogenetic models dating back 100 years. Philos Trans R Soc Lond B Biol Sci 2025;380(1919):20230297
  50. Sadler MC, Apostolov A, Cevallos C, Auwerx C, Ribeiro DM, Altman RB, Kutalik Z. Leveraging large-scale biobank EHRs to enhance pharmacogenetics of cardiometabolic disease medications. Nat Commun 2025;16(1):2913
  51. Saelens W, Pushkarev O, Deplancke B. ChromatinHD connects single-cell DNA accessibility and conformation to gene expression through scale-adaptive machine learning. Nat Commun 2025;16(1):317
  52. Samarasinghe KW, Kotlyar M, Vallet SD, Hayes C, Naba A, Jurisica I, Lisacek F, Ricard-Blum S. MatrixDB 2024: an increased coverage of extracellular matrix interactions, a new Network Explorer and a new web interface. Nucleic Acids Res 2025;53(d1):D1677-D1682
  53. Schubert C, Nguyen BD, Sichert A, Näpflin N, Sintsova A, Feer L, Näf J, Daniel BBJ, Steiger Y, von Mering C, Sauer U, Hardt WD. Monosaccharides drive Salmonella gut colonization in a context-dependent or -independent manner. Nat Commun 2025;16(1):1735
  54. Schuhknecht L, Ortmayr K, Jänes J, Bläsi M, Panoussis E, Bors S, Dorčáková T, Fuhrer T, Beltrao P, Zampieri M. A human metabolic map of pharmacological perturbations reveals drug modes of action. Nat Biotechnol 2025
  55. Servajean R, Alexandre A, Bitbol AF. Impact of complex spatial population structure on early and long-term adaptation in rugged fitness landscapes. Evolution 2025:qpaf025
  56. Sharma N, Das SG, Krug J, Traulsen A. Graph-structured populations elucidate the role of deleterious mutations in long-term evolution. Nat Commun 2025;16(1):2355
  57. Skribbe M, Soneson C, Stadler MB, Schwaiger M, Suma Sreechakram VN, Iesmantavicius V, Hess D, Moreno EPF, Braun S, Seebacher J, Smallwood SA, Bühler M. A comprehensive Schizosaccharomyces pombe atlas of physical transcription factor interactions with proteins and chromatin. Mol Cell 2025:S1097-2765(25)00099-1
  58. Soneson C, Shepherd L, Ramos M, Rue-Albrecht K, Rainer J, Pagès H, Carey VJ. Eleven quick tips for writing a Bioconductor package. PLoS Comput Biol 2025;21(3):e1012856
  59. Strütt S, Excoffier L, Peischl S. A generalized structured coalescent for purifying selection without recombination. Genetics 2025:iyaf013
  60. Sun M, Garnier L, Chevalier R, Roumain M, Wang C, Angelillo J, Montorfani J, Pick R, Brighouse D, Fournier N, Tarussio D, Tissot S, Lobaccaro JM, Petrova TV, Jandus C, Speiser DE, Kopf M, Pot C, Scheiermann C, Homicsko K, Muccioli GG, Garg AD, Hugues S. Lymphatic-derived oxysterols promote anti-tumor immunity and response to immunotherapy in melanoma. Nat Commun 2025;16(1):1217
  61. Sun Y, Silvestro D, Mathes GH, van der Heijden MGA, Müller-Schärer H. Eco-Evolutionary Dynamics of Plant-Soil Feedbacks Explain the Spread Potential of a Plant Invader Under Climate Warming and Biocontrol Herbivory. Glob Chang Biol 2025;31(3):e70110
  62. Szklarczyk D, Nastou K, Koutrouli M, Kirsch R, Mehryary F, Hachilif R, Hu D, Peluso ME, Huang Q, Fang T, Doncheva NT, Pyysalo S, Bork P, Jensen LJ, von Mering C. The STRING database in 2025: protein networks with directionality of regulation. Nucleic Acids Res 2025;53(d1):D730-D737
  63. Tadros DM, Racle J, Gfeller D. Predicting MHC-I ligands across alleles and species: how far can we go? Genome Med 2025;17(1):25
  64. Tarantelli C, Kayali O, Civanelli E, Cascione L, Mensah AA, Folloni C, Arribas AJ, Rinaldi A, Cmiljanovic V, Mondello P, Bertoni F. Targeting of PIM Kinases Shows Single Agent Efficacy and Synergizes With BCL2 Inhibitors in Diffuse Large B Cell Lymphoma of the ABC Subtype. Hematol Oncol 2025;43(2):e70055
  65. Tauriello G, Waterhouse AM, Haas J, Behringer D, Bienert S, Garello T, Schwede T. ModelArchive: A Deposition Database for Computational Macromolecular Structural Models. J Mol Biol 2025:168996
  66. Tegenfeldt F, Kuznetsov D, Manni M, Berkeley M, Zdobnov EM, Kriventseva EV. OrthoDB and BUSCO update: annotation of orthologs with wider sampling of genomes. Nucleic Acids Res 2025;53(d1):D516-D522
  67. Topaloudis A, Cumer T, Lavanchy E, Ducrest AL, Simon C, Machado AP, Paposhvili N, Roulin A, Goudet J. The recombination landscape of the barn owl, from families to populations. Genetics 2025;229(1):1-50
  68. Triscott J, Lehner M, Benjak A, Reist M, Emerling BM, Ng CKY, de Brot S, Rubin MA. Loss of PI5P4Kα Slows the Progression of a Pten Mutant Basal Cell Model of Prostate Cancer. Mol Cancer Res 2025;23(1):33-45
  69. Truman K, Vaughan TG, Gavryushkin A, Gavryushkina AS. The Fossilized Birth-Death Model Is Identifiable. Syst Biol 2025;74(1):112-123
  70. Träger LK, Degen M, Pereira J, Durairaj J, Teixeira RD, Hiller S, Huguenin-Dezot N. Structural basis for cooperative ssDNA binding by bacteriophage protein filament P12. Nucleic Acids Res 2025;53(5):gkaf132
  71. Usart M, Kimmerlin Q, Stetka J, Stoll C, Rai S, Almeida Fonseca T, Karjalainen R, Hao-Shen H, Roux J, El Taher A, Lynch D, Makukhin N, Ciulli A, Skoda RC. Loss of Socs2 improves molecular responses to IFNα in a mouse model of myeloproliferative neoplasms driven by JAK2-V617F. Leukemia 2025
  72. Van Hecke M, Beerenwinkel N, Lootens T, Fostier J, Raedt R, Marchal K. ELLIPSIS: robust quantification of splicing in scRNA-seq. Bioinformatics 2025;41(2):btaf028
  73. Vande Moortele T, Verschaffelt P, Huang Q, Doncheva NT, Holstein T, Jachmann C, Dawyndt P, Martens L, Mesuere B, Van Den Bossche T. PathwayPilot: A User-Friendly Tool for Visualizing and Navigating Metabolic Pathways. Mol Cell Proteomics 2025;24(3):100918
  74. Windels EM, Valenzuela Agüí C, de Jong BC, Meehan CJ, Loiseau C, Goig GA, Zwyer M, Borrell S, Brites D, Gagneux S, Stadler T. Onset of infectiousness explains differences in transmissibility across Mycobacterium tuberculosis lineages. Epidemics 2025;51:100821
  75. Wolski WE, Grossmann J, Schwarz L, Leary P, Türker C, Nanni P, Schlapbach R, Panse C. prolfquapp ─ A User-Friendly Command-Line Tool Simplifying Differential Expression Analysis in Quantitative Proteomics. J Proteome Res 2025;24(2):955-965
  76. Yang L, Sadler MC, Altman RB. Genetic association studies using disease liabilities from deep neural networks. Am J Hum Genet 2025;112(3):675-692
  77. Zdouc MM, Blin K, Louwen NLL, Navarro J, Loureiro C, Bader CD, Bailey CB, Barra L, Booth TJ, Bozhüyük KAJ, Cediel-Becerra JDD, Charlop-Powers Z, Chevrette MG, Chooi YH, D'Agostino PM, de Rond T, Del Pup E, Duncan KR, Gu W, Hanif N, Helfrich EJN, Jenner M, Katsuyama Y, Korenskaia A, Krug D, Libis V, Lund GA, Mantri S, Morgan KD, Owen C, Phan CS, Philmus B, Reitz ZL, Robinson SL, Singh KS, Teufel R, Tong Y, Tugizimana F, Ulanova D, Winter JM, Aguilar C, Akiyama DY, Al-Salihi SAA, Alanjary M, Alberti F, Aleti G, Alharthi SA, Rojo MYA, Arishi AA, Augustijn HE, Avalon NE, Avelar-Rivas JA, Axt KK, Barbieri HB, Barbosa JCJ, Barboza Segato LG, Barrett SE, Baunach M, Beemelmanns C, Beqaj D, Berger T, Bernaldo-Agüero J, Bettenbühl SM, Bielinski VA, Biermann F, Borges RM, Borriss R, Breitenbach M, Bretscher KM, Brigham MW, Buedenbender L, Bulcock BW, Cano-Prieto C, Capela J, Carrion VJ, Carter RS, Castelo-Branco R, Castro-Falcón G, Chagas FO, Charria-Girón E, Chaudhri AA, Chaudhry V, Choi H, Choi Y, Choupannejad R, Chromy J, Donahey MSC, Collemare J, Connolly JA, Creamer KE, Crüsemann M, Cruz AA, Cumsille A, Dallery JF, Damas-Ramos LC, Damiani T, de Kruijff M, Martín BD, Sala GD, Dillen J, Doering DT, Dommaraju SR, Durusu S, Egbert S, Ellerhorst M, Faussurier B, Fetter A, Feuermann M, Fewer DP, Foldi J, Frediansyah A, Garza EA, Gavriilidou A, Gentile A, Gerke J, Gerstmans H, Gomez-Escribano JP, González-Salazar LA, Grayson NE, Greco C, Gomez JEG, Guerra S, Flores SG, Gurevich A, Gutiérrez-García K, Hart L, Haslinger K, He B, Hebra T, Hemmann JL, Hindra H, Höing L, Holland DC, Holme JE, Horch T, Hrab P, Hu J, Huynh TH, Hwang JY, Iacovelli R, Iftime D, Iorio M, Jayachandran S, Jeong E, Jing J, Jung JJ, Kakumu Y, Kalkreuter E, Kang KB, Kang S, Kim W, Kim GJ, Kim H, Kim HU, Klapper M, Koetsier RA, Kollten C, Kovács ÁT, Kriukova Y, Kubach N, Kunjapur AM, Kushnareva AK, Kust A, Lamber J, Larralde M, Larsen NJ, Launay AP, Le NT, Lebeer S, Lee BT, Lee K, Lev KL, Li SM, Li YX, Licona-Cassani C, Lien A, Liu J, Lopez JAV, Machushynets NV, Macias MI, Mahmud T, Maleckis M, Martinez-Martinez AM, Mast Y, Maximo MF, McBride CM, McLellan RM, Bhatt KM, Melkonian C, Merrild A, Metsä-Ketelä M, Mitchell DA, Müller AV, Nguyen GS, Nguyen HT, Niedermeyer THJ, O'Hare JH, Ossowicki A, Ostash BO, Otani H, Padva L, Paliyal S, Pan X, Panghal M, Parade DS, Park J, Parra J, Rubio MP, Pham HT, Pidot SJ, Piel J, Pourmohsenin B, Rakhmanov M, Ramesh S, Rasmussen MH, Rego A, Reher R, Rice AJ, Rigolet A, Romero-Otero A, Rosas-Becerra LR, Rosiles PY, Rutz A, Ryu B, Sahadeo LA, Saldanha M, Salvi L, Sánchez-Carvajal E, Santos-Medellin C, Sbaraini N, Schoellhorn SM, Schumm C, Sehnal L, Selem N, Shah AD, Shishido TK, Sieber S, Silviani V, Singh G, Singh H, Sokolova N, Sonnenschein EC, Sosio M, Sowa ST, Steffen K, Stegmann E, Streiff AB, Strüder A, Surup F, Svenningsen T, Sweeney D, Szenei J, Tagirdzhanov A, Tan B, Tarnowski MJ, Terlouw BR, Rey T, Thome NU, Torres Ortega LR, Tørring T, Trindade M, Truman AW, Tvilum M, Udwary DW, Ulbricht C, Vader L, van Wezel GP, Walmsley M, Warnasinghe R, Weddeling HG, Weir ANM, Williams K, Williams SE, Witte TE, Rocca SMW, Yamada K, Yang D, Yang D, Yu J, Zhou Z, Ziemert N, Zimmer L, Zimmermann A, Zimmermann C, van der Hooft JJJ, Linington RG, Weber T, Medema MH. MIBiG 4.0: advancing biosynthetic gene cluster curation through global collaboration. Nucleic Acids Res2025;53(d1):D678-D690
  78. Zouaghi Y, Alpern D, Gardeux V, Russeil J, Deplancke B, Santoni F, Pitteloud N, Messina A. Transcriptomic profiling of murine GnRH neurons reveals developmental trajectories linked to human reproduction and infertility. Theranostics 2025;15(8):3673-3692
  79. Zwaans A, Seidel S, Manceau M, Stadler T. A Bayesian phylodynamic inference framework for single-cell CRISPR/Cas9 lineage tracing barcode data with dependent target sites. Philos Trans R Soc Lond B Biol Sci 2025;380(1919):20230318
  80. de Korne-Elenbaas J, Caduff L, Lison A, McLeod R, Pitton M, Gan C, Julian TR. Design, validation, and implementation of multiplex digital PCR assays for simultaneous quantification of multiple targets. Lett Appl Microbiol 2025;78(1):ovae137
  81. de Vries PLM, Baud D, Baggio S, Ceulemans M, Favre G, Gerbier E, Legardeur H, Maisonneuve E, Pena-Reyes C, Pomar L, Winterfeld U, Panchaud A. Enhancing perinatal health patient information through ChatGPT - An accuracy study. PEC Innov 2025;6:100381

Browse other years