ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG


NGS bioinformatics quality control and variant annotation for cancer diagnosis
01 September 2020
For-profit: 300 CHF
This course is organised by SIB Swiss Institute of Bioinformatics, in collaboration with the Clinical Pathology Division of the University Hospital of Geneva (HUG).
Updated August 18, 2020: This course is postponed; more information will be sent to the registered participants.
Overview
Cutting-edge technologies, like next-generation-sequencing (NGS) applied to gene panels, combined with the development of targeted therapies are now revolutionising clinical practice in oncology. In this context, clinical bioinformatics plays a pivotal role, ensuring that NGS data are converted into clinically relevant knowledge. While bioinformatics analysis pipelines can be automated to some extent, they still require human expertise to perform robust quality control and annotation/interpretation of somatic variants.
This course therefore aims at deepening the underlying bioinformatics concepts for professionals from clinical labs working on NGS data, to improve their skills in spotting artifacts from NGS data and annotating true somatic variants. This interactive course will consist of lectures alternating with study cases using a bioinformatics pipeline for cancer diagnosis, and group discussions/presentations.
Programme
I. NGS BIOINFORMATICS PIPELINE
Overview of a bioinformatics analysis pipeline: from FASTQ to BAM, VCF and annotation.
II: BIOINFORMATICS QUALITY CONTROL
Quality control throughout the NGS pipeline
Variant-level quality control: common measures and thresholds for IonTorrent and Illumina
Study case – Spotting data artifacts among true variants
III: ANNOTATION & INTERPRETATION
Clinical significance: pathogenicity and actionability
Literature and other public databases: essentials and extras
From variant to gene, assessing functional impact
Study case – Annotation with literature and other public databases
Audience
Priority will be given to members of clinical laboratories in Switzerland with some experience in NGS somatic variant analysis.
Learning objectives
At the end of the course, the participants are expected to:
- Participants improve their skills in NGS somatic variant annotation through theory and practical hands-on sessions related to their daily clinical practice.
- Participants share and discuss their own practices, addressing topics from Ion Torrent and Illumina technologies.
Prerequisites
Knowledge / competencies
Some experience in NGS variant analysis.
Technical
Participants must bring a laptop.
Application
Registration is free of charge for HUG staff (valid HUG email required). For other academics, a registration fee of CHF 60.- applies.
Deadline for registration and free-of-charge cancellation is set is set to 01/09/2020. Cancellation after this date will not be reimbursed. Please note that participation to SIB courses is subject to our general conditions.
You will be informed by email of your registration confirmation.
Venue and Time
University of Lausanne, Amphipole building, Room 342 (Metro M1 line, Sorge station).
The course will start at 9:00 and end around 17:00. Precise information will be provided to the participants in due time.
Additional information
- Participation to this course is recognized by SSPath with 7 credits of continuing education
- The course will be taught in English.
- Teachers: Dr. Yann Christinat (HUG Molecular Pathology), Dr. Aitana Lebrand (SIB Clinical Bioinformatics).
- Scientific responsibility: Prof. Thomas McKee (Head HUG Molecular Pathology).
- Hospital contributor: Dr. Yann Christinat (HUG Molecular Pathology).
- Course coordinators: Dr. Aitana Lebrand (SIB Clinical Bioinformatics) and Dr. Monique Zahn (SIB Training).
You are welcome to register to the SIB courses mailing list to be informed of all future courses and workshops, as well as all important deadlines using the form here.
SIB abides by the ELIXIR Code of Conduct. Participants of SIB courses are also required to abide by the same code.
For more information, please contact training@sib.swiss.