

ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ISMB / ECCB 2025

The annual international conference on Intelligent Systems for Molecular Biology (ISMB) is the flagship meeting of the International Society for Computational Biology (ISCB). The 2025 meeting is the 33rd ISMB conference, which has grown to become the world's largest bioinformatics and computational biology conference. Joining forces with the European Conference on Computational Biology (the 24th Annual Conference), ISMB/ECCB 2025 will be the year's most important computational biology event!
Join us in Liverpool (20-24 July), where SIB will host a booth.
SIB will be represented with the following presentations:
- Amos Bairoch (a keynote talk) | Monday 21 July 2025, 09:00-10:00
- Alan Bridge(on large language models) | date TBC
- Cristina Casals Casas (on Gene Ontology Causal Activity Models) | poster presentation Tuesday 22 and Wednesday 23 July
- Marc Robinson-Rechavi (Evolution of function in light of gene expression) | Tuesday 22 July, 11:30-12:10
- Marc Feuermann and Pascale Gaudet (Human gene functions derived from evolutionary modeling) | Tuesday 22 July, 12:40-12:50
The international meeting will be held in-person at the ACC Liverpool,a leading conference and event venue in the UK, and virtually through ISCB's Nucleus platform.
The principal focus of the joint ISMB/ECCB conference is on the development and application of advanced computational methods to address biological problems, and brings together researchers from computer science, bioinformatics, computational biology, molecular biology, mathematics, statistics, and related fields. The conference provides a multidisciplinary platform for sharing the latest advancements in bioinformatics and computational biology, fostering new dialogues and perspectives to shape the future of the field.