

ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ISMB / ECCB 2025

The annual international conference on Intelligent Systems for Molecular Biology (ISMB) is the flagship meeting of the International Society for Computational Biology (ISCB). The 2025 meeting is the 33rd ISMB conference, which has grown to become the world's largest bioinformatics and computational biology conference. Joining forces with the European Conference on Computational Biology (the 24th Annual Conference), ISMB/ECCB 2025 will be the year's most important computational biology event!
Join us in Liverpool (20-24 July), where SIB will be at booth #26.
SIB will be represented with the following presentations:
- Amos Bairoch 'Plus ça change, plus c'est la même chose": from Swiss-Prot to Cellosaurus, 40 years of biocuration' | Monday 21 July 2025, 10:00-11:00, room 01A
- Marc Robinson-Rechavi 'Evolution of function in light of gene expression' | Tuesday 22 July, 12:30-13:10, room 11A
- Kristian Axelsen
Poster B-234: Rhea, a FAIR Resource for Expert Curated Biochemical and Transport Reactions
Track: Function: Gene and Protein Function Annotation
Session B: 22 July 2025 at 10:00-11:20 and 16:00-16:40. - Charles Bernard will present “EdgeHOG: Scalable and Fine-Grained Ancestral Gene Order Inference Across the Tree of Life” on Monday, 21 July, 16:40 in room 11A.
- Maria Brbic will present “Predicting Perturbation Effects: Are We Really There?” on Monday 21 July, at 14:45 in room 12.
- Cristina Casals Casas
Poster C-030: Modeling Human Functional Networks with Gene Ontology Causal Activity Models (GO-CAMs)
Track: BOKR (Bio-Ontologies and Knowledge Representation)
Session C: 23 July 2025 at 10:00-11:20 and 16:00-16:40, with a 1 minute presentation at poster madness: 23 July 2025 at 12:50. - David Moi will present “Structural Phylogenetics: toward an evolutionary model capturing both sequence and structure” on Tuesday 22 July at 12:00 in room 03B.
- Marc Feuermann
Poster B-242: A compendium of human gene functions derived from evolutionary modeling
Track: Function: Gene and Protein Function Annotation
Session B: 22 July 2025 at 10:00-11:20 and 16:00-16:40. - Anastasia Sveshnikova
Poster B-398: Advancing diagnostics in inherited metabolic diseases through enhanced metabolic modeling of lipid metabolism
Track: SysMod: Computational Modeling of Biological Systems
Session B: 22 July 2025 at 10:00-11:20 and 16:00-16:40
The international meeting will be held in-person at the ACC Liverpool, a leading conference and event venue in the UK, and virtually through ISCB's Nucleus platform.
The principal focus of the joint ISMB/ECCB conference is on the development and application of advanced computational methods to address biological problems, and brings together researchers from computer science, bioinformatics, computational biology, molecular biology, mathematics, statistics, and related fields. The conference provides a multidisciplinary platform for sharing the latest advancements in bioinformatics and computational biology, fostering new dialogues and perspectives to shape the future of the field.