ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
1st Swiss Enterovirus Symposium
The Swiss Enterovirus Symposium is a new, high-impact meeting uniting emerging and established leaders in virology, epidemiology, bioinformatics, and clinical science to drive progress in enterovirus research. Enteroviruses are an increasingly important yet underrepresented global health challenge, with evolving genotypes like EV-A71 and EV-D68 linked to rising disease burden. This symposium creates a much-needed platform to spotlight cutting-edge science, new detection technologies, and clinical insights.
The event is expected to welcome 60 to 80 participants from across Switzerland and Europe, primarily motivated students and early-career researchers, alongside leading keynote experts. The programme will combine selected abstract presentations, posters, and invited talks.
The conference is organized primarily by PhD students from the Epidemiology and Virus Evolution group of SIB Group Leader Emma Hodcroft at the Swiss Tropical and Public Health Institute and the University of Basel.
Preliminary agenda:
- Day 1 (Monday evening): Arrival, registration, opening keynote lecture, and informal networking during the Welcome apéro and dinner.
- Day 2-3 (Tuesday-Wednesday): Scientific sessions with keynote lectures, contributed talks, poster sessions, and structured discussions. Topics include surveillance, phylogenetics, modeling, immunity, bioinformatics, detection methods, and clinical advances.
- Day 4 (Thursday morning): Student-led workshops on phylogenetic visualization with Nextstrain, dataset preparation with Nextclade, and viral genome sharing using Pathoplexus.