

ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
Bioinformatics Day 2025

The Interfaculty Bioinformatics Unit at the University of Bern is thrilled to announce the Margaret Dayhoff Centenary Event taking place on 11 March 2025, in Bern! See the final programme.
This special event celebrates the legacy of Margaret Dayhoff—marking her 100th birthday and the 60th anniversary of her groundbreaking Atlas of Protein Sequence and Structure, the first publication in bioinformatics, while spotlighting the remarkable contributions of women scientists leading the charge in bioinformatics today.
Don't miss the closing keynote talk by SIB Group Leader Raphäelle Luisier and join us for a day filled with:
- Inspiring talks from leading bioinformaticians
- Engaging panel discussions
- Interactive round tables
Parallel sessions:
- Session I: 'History and Future of Swiss Bioinformatics'
Featuring SIB representatives: Marie Dangles, Patricia Palagi, and Marianna Rapsomaniki - Session II: 'Career Panel'
Featuring SIB representatives: Natasha Glover, Séverine Duvaud, and Charlotte Soneson - 'Bioinformatics Spotlights of the Present'
Featuring SIB representatives: Marianna Rapsomaniki, Natasha Glover, and Emma Hodcroft
Whether you’re a seasoned researcher, an aspiring bioinformatician, or simply passionate about science, this event is a unique opportunity to connect, learn, and be inspired!
Organized by SIB Group of Rémy Bruggman.
Save the date: 11 March 2025
Deadline to register: 14 February 2025
Location: Kuppelraum, Hochschulstrasse 4, University of Bern