ATGACGGATGCCGGAATTGGCATGACGGATGCCGGAATTGGCACATAACAAGTACTGCTCGGTCCTTAAGCTGTATTGCACCATATGACGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ATGACGGATGCCGGAATTGGCATGACGGATGCCGGAATTGGCACATAACAAGTACTGCTCGGTCCTTAAGCTGTATTGCACCATATGACGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
Gathering to tackle the most pressing challenges in the field

Conferences

Every year, SIB alternates between one of two biennial conferences; The Swiss Bioinformatic Summit - the SIB days which brings together SIB’s lively community to share the latest developments in bioinformatics and the [BC]2 Basel Computational Biology Conference, Switzerland's leading event in the domain gathering experts in academia, industry, and healthcare from around the world. In addition to these flagship conferences, SIB also supports and participates in scientific events to promote SIB Resources and discoveries. Find below the list of upcoming events where you can find us:

ISMB / ECCB 2025

20–24 July 2025
Liverpool, UK
ISMB/ECCB 2025 taking place in Liverpool
The annual international conference on Intelligent Systems for Molecular Biology (ISMB) is the flagship meeting of the International Society for Computational Biology (ISCB). The 2025 meeting is the...

5th Clinic Meets Data Science Symposium

28 August 2025
Basel, Switzerland
a dna illustration a symposium on clinics meet data science
The symposium will showcase current developments in clinical data science, highlight state-of-the-art and future applications and tools and discuss possibilities and opportunities that data science...

[BC]2 Basel Computational Biology Conference

8–10 September 2025
Basel, Switzerland
Logo BC2
The 2025 edition of the [BC]2 Basel Computational Biology Conference, themed "Bioinformatics meets AI: shaping the future of data-driven biology," will take place 8-10 September 2025 in Basel...

Computational Biology Symposium

18–19 September 2025
Lausanne, Switzerland
Banner of the computational biology symposium
Computational biology is everywhere. As biology has developed into a vast field over the last century, available data size increased both in terms of the analyzed samples and assessed biological...

aiHealth2025

10–11 November 2025
Basel, Switzerland
a illustration for the Annual Conference on Artificial Intelligence in Health
The 2nd International Annual Conference on Artificial Intelligence in Health (aiHealth2025) will take place 10-11 November 2025 at the University of Applied Sciences and Arts Northwestern Switzerland...

ECCB 2026

31 August – 4 September 2026
Geneva, Switzerland
ECCB logo with text and dates
SIB will host the 25th European Conference on Computational Biology (ECCB) in Geneva, Switzerland, from 31 August to 4 September 2026. Save the date, and subscribe to our newsletter for updates as we...