ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
Workshop on Epigenomics Data Analysis
01 June 2022
01 June 2022
For-profit: 0 CHF
This workshop is co-organized with Staromics, Microbiology, Molecular Plant Sciences and Ecology and Evolution, 4 doctoral programs of CUSO.
Overview
Epigenetics modifications are important modifications of the DNA or the chromatin that affect the bacteria and higher eukaryotes. These modifications can be transmitted from generation to generation, carrying information affecting the gene expression in the off-springs. Current next generation sequencing (NGS) technologies allow for the detection of those modifications at the genome level introducing the «epigenomics». In this workshop we will explore the bioinformatics methods available for studying these data. Since these can be divided in two main categories, DNA methylation on the one hand and chromatin modifications on the other hand, the workshop will reflect this with a first day dedicated to DNA methylation analysis both in prokaryotes and in eukaryotes. The second day will focus on the chromatin modifications (histones and other proteins) in normal and cancerous tissues.
This workshop is coupled with the symposium Advances in Epigenetics and Epigenomics that is going to take place the first 3 days of this week (27-29 June 2022). Please note that although at the same location, these are two independent events, with separate registrations.
Audience
This course is addressed to life scientists who want to learn analysis related to epigenetics modifications.
Learning outcomes
At the end of the course, the participants are expected to:
- have learned about DNA methylation data analysis using R packages and web tools.
- have learned about analysis of chromatin modifications using R packages and web tools.
Prerequisites
Knowledge / competencies
- basic knowlege of epigenetic processes
- basic knowledge of command line (UNIX)
- basic knowledge of R
Technical
You are required to have your own computer with R/RStudio installed, as well as packages to be installed in advance, and that will be communicated to the participants on due time.
Program
Day 1
- Short general introduction about epigenomics data.
- Prokaryotic DNA methylation (lecture & hands-on).
- Eukaryotic DNA methylation (lecture & hands-on).
Day 2
- Histone modification and chromatine re-arrangement.
- Cancer epigenomics.
Application
Registration is open, but pay attention that there will be a priority for the members of CUSO. This means that it could take some time before you get contacted by the organizers. So please, don't contact us about this, thank you.
INFORMATION AND REGISTRATION LINK for the WORKSHOP: click here
INFORMATION AND REGISTRATION LINK for the SYMPOSIUM: click here
Venue and Time
This workshop will take place at the Centre de conférences et de séminaires, Caux Palace, above Montreux.
Additional information
Coordination: Grégoire Rossier (SIB), Corinne Dentan (Staromics).
You are welcome to register to the SIB courses mailing list to be informed of all future courses and workshops, as well as all important deadlines using the form here.
SIB abides by the ELIXIR Code of Conduct. Participants of SIB courses are also required to abide by the same code.
For more information, please contact training@sib.swiss.