ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
54th European Mathematical Genetics Meeting
The EMGM is an annual scientific conference that brings together researchers working at the intersection of statistics, mathematics, and human genetics. EMGM 2026 will continue the tradition of fostering collaboration and innovation in the field by providing a platform for early-career and established scientists to present their latest research, exchange ideas, and explore new directions in genetic epidemiology, statistical genetics, and related disciplines. The meeting features invited talks, contributed presentations, and informal discussions in a collegial and interactive setting.
The 54th edition of EMGM, of which SIB is one of the sponsors, will cover a broad range of topics, including:
- Rare variant analysis
- Fine-mapping, gene-, tissue-, and pathway-enrichment methods
- Machine learning and AI for omics
- Trait prediction and personalized health
- Complex trait genetics
- Integrative omics
- Population genetics
and more.
Invited speakers include Dr. Tim Frayling, Joelle Mbatchou, Ph.D., Dr. Eleonora Porcu, and Dr. Marylyn Ritchie.
Register before 9 April 2026 and submit your abstract by 15 February 2026.