ATGACGGATGCCGGAATTGGCATGACGGATGCCGGAATTGGCACATAACAAGTACTGCTCGGTCCTTAAGCTGTATTGCACCATATGACGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
Peer-reviewed papers and preprints by our members

Scientific publications 2024

Bioinformatics has become essential to convert biological questions into answers. Discover the breadth of our scientists' work and contributions through their publications. 

 

Source: Europe PMC, latest update: 31.12.2024

Discover the SIB Remarkable Outputs 2023

The Remarkable Outputs are selected by the Award Committee to provide the community with the yearly achievements by SIB Scientists that are particularly deserving attention. From new algorithms to detect disease-related genes to exploring the origins of sexual reproduction, discover this shortlist of publications, software tools, databases and outreach projects.

Peer-reviewed articles and preprints

  1. Abbara A, Pagani L, García-Pareja C, Bitbol AF. Mutant fate in spatially structured populations on graphs: Connecting models to experiments. PLoS Comput Biol 2024;20(9):e1012424
  2. Abkallo HM, Arbuthnot P, Auer TO, Berger DK, Burger J, Chakauya E, Concordet JP, Diabate A, Di Donato V, Groenewald JH, Guindo A, Koekemoer LL, Nazare F, Nolan T, Okumu F, Orefuwa E, Paemka L, Prieto-Godino L, Runo S, Sadler M, Tesfaye K, Tripathi L, Wondji C. Making genome editing a success story in Africa. Nat Biotechnol 2024;42(4):551-554
  3. Adato O, Sloutskin A, Komemi H, Brabb I, Duttke S, Bucher P, Unger R, Juven-Gershon T. ElemeNT 2023: an enhanced tool for detection and curation of core promoter elements.Bioinformatics 2024;40(3):btae110
  4. Ahel J, Pandey A, Schwaiger M, Mohn F, Basters A, Kempf G, Andriollo A, Kaaij L, Hess D, Bühler M. ChAHP2 and ChAHP control diverse retrotransposons by complementary activities 2024
  5. Ahel J, Pandey A, Schwaiger M, Mohn F, Basters A, Kempf G, Andriollo A, Kaaij L, Hess D, Bühler M. ChAHP2 and ChAHP control diverse retrotransposons by complementary activities. Genes Dev 2024;38(11-12):554-568
  6. Akarsu H, Liljander AM, Lacasta A, Ssajjakambwe P, Brodard I, Cherbuin JDR, Torres-Puig S, Perreten V, Kuhnert P, Labroussaa F, Jores J. Canine Staphylococcaceae circulating in a Kenyan animal shelter. Microbiol Spectr 2024;12(2):e0292423
  7. Albani M, Fassi EMA, Moretti RM, Garofalo M, Montagnani Marelli M, Roda G, Sgrignani J, Cavalli A, Grazioso G. Computational Design of Novel Cyclic Peptides Endowed with Autophagy-Inhibiting Activity on Cancer Cell Lines. Int J Mol Sci 2024;25(9):4622
  8. Alexandre A, Abbara A, Fruet C, Loverdo C, Bitbol AF. Bridging Wright-Fisher and Moran models. J Theor Biol 2025;599:112030
  9. Allen BJ, Hill DJ, Burke AM, Clark M, Marchant R, Stringer LC, Williams DR, Lyon C. Projected future climatic forcing on the global distribution of vegetation types. Philos Trans R Soc Lond B Biol Sci 2024;379(1902):20230011
  10. Allentoft ME, Sikora M, Fischer A, Sjögren KG, Ingason A, Macleod R, Rosengren A, Schulz Paulsson B, Jørkov MLS, Novosolov M, Stenderup J, Price TD, Fischer Mortensen M, Nielsen AB, Ulfeldt Hede M, Sørensen L, Nielsen PO, Rasmussen P, Jensen TZT, Refoyo-Martínez A, Irving-Pease EK, Barrie W, Pearson A, Sousa da Mota B, Demeter F, Henriksen RA, Vimala T, McColl H, Vaughn A, Vinner L, Renaud G, Stern A, Johannsen NN, Ramsøe AD, Schork AJ, Ruter A, Gotfredsen AB, Henning Nielsen B, Brinch Petersen E, Kannegaard E, Hansen J, Buck Pedersen K, Pedersen L, Klassen L, Meldgaard M, Johansen M, Uldum OC, Lotz P, Lysdahl P, Bangsgaard P, Petersen PV, Maring R, Iversen R, Wåhlin S, Anker Sørensen S, Andersen SH, Jørgensen T, Lynnerup N, Lawson DJ, Rasmussen S, Korneliussen TS, Kjær KH, Durbin R, Nielsen R, Delaneau O, Werge T, Kristiansen K, Willerslev E. 100 ancient genomes show repeated population turnovers in Neolithic Denmark. Nature 2024;625(7994):329-337
  11. Allentoft ME, Sikora M, Refoyo-Martínez A, Irving-Pease EK, Fischer A, Barrie W, Ingason A, Stenderup J, Sjögren KG, Pearson A, Sousa da Mota B, Schulz Paulsson B, Halgren A, Macleod R, Jørkov MLS, Demeter F, Sørensen L, Nielsen PO, Henriksen RA, Vimala T, McColl H, Margaryan A, Ilardo M, Vaughn A, Fischer Mortensen M, Nielsen AB, Ulfeldt Hede M, Johannsen NN, Rasmussen P, Vinner L, Renaud G, Stern A, Jensen TZT, Scorrano G, Schroeder H, Lysdahl P, Ramsøe AD, Skorobogatov A, Schork AJ, Rosengren A, Ruter A, Outram A, Timoshenko AA, Buzhilova A, Coppa A, Zubova A, Silva AM, Hansen AJ, Gromov A, Logvin A, Gotfredsen AB, Henning Nielsen B, González-Rabanal B, Lalueza-Fox C, McKenzie CJ, Gaunitz C, Blasco C, Liesau C, Martinez-Labarga C, Pozdnyakov DV, Cuenca-Solana D, Lordkipanidze DO, En'shin D, Salazar-García DC, Price TD, Borić D, Kostyleva E, Veselovskaya EV, Usmanova ER, Cappellini E, Brinch Petersen E, Kannegaard E, Radina F, Eylem Yediay F, Duday H, Gutiérrez-Zugasti I, Merts I, Potekhina I, Shevnina I, Altinkaya I, Guilaine J, Hansen J, Aura Tortosa JE, Zilhão J, Vega J, Buck Pedersen K, Tunia K, Zhao L, Mylnikova LN, Larsson L, Metz L, Yepiskoposyan L, Pedersen L, Sarti L, Orlando L, Slimak L, Klassen L, Blank M, González-Morales M, Silvestrini M, Vretemark M, Nesterova MS, Rykun M, Rolfo MF, Szmyt M, Przybyła M, Calattini M, Sablin M, Dobisíková M, Meldgaard M, Johansen M, Berezina N, Card N, Saveliev NA, Poshekhonova O, Rickards O, Lozovskaya OV, Gábor O, Uldum OC, Aurino P, Kosintsev P, Courtaud P, Ríos P, Mortensen P, Lotz P, Persson P, Bangsgaard P, de Barros Damgaard P, Vang Petersen P, Martinez PP, Włodarczak P, Smolyaninov RV, Maring R, Menduiña R, Badalyan R, Iversen R, Turin R, Vasilyev S, Wåhlin S, Borutskaya S, Skochina S, Sørensen SA, Andersen SH, Jørgensen T, Serikov YB, Molodin VI, Smrcka V, Merts V, Appadurai V, Moiseyev V, Magnusson Y, Kjær KH, Lynnerup N, Lawson DJ, Sudmant PH, Rasmussen S, Korneliussen TS, Durbin R, Nielsen R, Delaneau O, Werge T, Racimo F, Kristiansen K, Willerslev E. Population genomics of post-glacial western Eurasia. Nature 2024;625(7994):301-311
  12. Allentoft ME, Sikora M, Refoyo-Martínez A, Irving-Pease EK, Fischer A, Barrie W, Ingason A, Stenderup J, Sjögren KG, Pearson A, Sousa da Mota B, Schulz Paulsson B, Halgren A, Macleod R, Jørkov MLS, Demeter F, Sørensen L, Nielsen PO, Henriksen RA, Vimala T, McColl H, Margaryan A, Ilardo M, Vaughn A, Fischer Mortensen M, Nielsen AB, Ulfeldt Hede M, Johannsen NN, Rasmussen P, Vinner L, Renaud G, Stern A, Jensen TZT, Scorrano G, Schroeder H, Lysdahl P, Ramsøe AD, Skorobogatov A, Schork AJ, Rosengren A, Ruter A, Outram A, Timoshenko AA, Buzhilova A, Coppa A, Zubova A, Silva AM, Hansen AJ, Gromov A, Logvin A, Gotfredsen AB, Henning Nielsen B, González-Rabanal B, Lalueza-Fox C, McKenzie CJ, Gaunitz C, Blasco C, Liesau C, Martinez-Labarga C, Pozdnyakov DV, Cuenca-Solana D, Lordkipanidze DO, En'shin D, Salazar-García DC, Price TD, Borić D, Kostyleva E, Veselovskaya EV, Usmanova ER, Cappellini E, Brinch Petersen E, Kannegaard E, Radina F, Eylem Yediay F, Duday H, Gutiérrez-Zugasti I, Merts I, Potekhina I, Shevnina I, Altinkaya I, Guilaine J, Hansen J, Aura Tortosa JE, Zilhão J, Vega J, Buck Pedersen K, Tunia K, Zhao L, Mylnikova LN, Larsson L, Metz L, Yepiskoposyan L, Pedersen L, Sarti L, Orlando L, Slimak L, Klassen L, Blank M, González-Morales M, Silvestrini M, Vretemark M, Nesterova MS, Rykun M, Rolfo MF, Szmyt M, Przybyła M, Calattini M, Sablin M, Dobisíková M, Meldgaard M, Johansen M, Berezina N, Card N, Saveliev NA, Poshekhonova O, Rickards O, Lozovskaya OV, Gábor O, Uldum OC, Aurino P, Kosintsev P, Courtaud P, Ríos P, Mortensen P, Lotz P, Persson P, Bangsgaard P, de Barros Damgaard P, Vang Petersen P, Martinez PP, Włodarczak P, Smolyaninov RV, Maring R, Menduiña R, Badalyan R, Iversen R, Turin R, Vasilyev S, Wåhlin S, Borutskaya S, Skochina S, Sørensen SA, Andersen SH, Jørgensen T, Serikov YB, Molodin VI, Smrcka V, Merts V, Appadurai V, Moiseyev V, Magnusson Y, Kjær KH, Lynnerup N, Lawson DJ, Sudmant PH, Rasmussen S, Korneliussen TS, Durbin R, Nielsen R, Delaneau O, Werge T, Racimo F, Kristiansen K, Willerslev E. Publisher Correction: Population genomics of post-glacial western Eurasia. Nature 2024;626(7997):E3
  13. Altenhoff A, Nevers Y, Tran V, Jyothi D, Martin M, Cosentino S, Majidian S, Marcet-Houben M, Fuentes-Palacios D, Persson E, Walsh T, Lecompte O, Gabaldón T, Kelly S, Hu Y, Iwasaki W, Capella-Gutierrez S, Dessimoz C, Thomas PD, Ebersberger I, Sonnhammer E. New developments for the Quest for Orthologs benchmark service. NAR Genom Bioinform 2024;6(4):lqae167
  14. Altenhoff AM, Warwick Vesztrocy A, Bernard C, Train CM, Nicheperovich A, Prieto Baños S, Julca I, Moi D, Nevers Y, Majidian S, Dessimoz C, Glover NM. OMA orthology in 2024: improved prokaryote coverage, ancestral and extant GO enrichment, a revamped synteny viewer and more in the OMA Ecosystem. Nucleic Acids Res 2024;52(d1):D513-D521
  15. Anderegg MA, Olinger EG, Bargagli M, Geraghty R, Taylor L, Nater A, Bruggmann R, Sayer JA, Vogt B, Schaller A, Fuster DG. Prevalence and characteristics of genetic disease in adult kidney stone formers. Nephrol Dial Transplant 2024;39(9):1426-1441
  16. Andreatta M, Hérault L, Gueguen P, Gfeller D, Berenstein AJ, Carmona SJ. Semi-supervised integration of single-cell transcriptomics data. Nat Commun 2024;15(1):872
  17. Andreoti TA, Maiolo M, Tuleja A, Döring Y, Schaller A, Vassella E, Boon LM, Baumgartner I, Bernhard SM, Zweier C, Vikkula M, Rössler J. Non-Hotspot PIK3CA Variants Have Higher Variant Allele Frequency and are More Common in Syndromic Vascular Malformations. Am J Med Genet A 2025;197(2):e63883
  18. Anglada-Girotto M, Ciampi L, Bonnal S, Head SA, Miravet-Verde S, Serrano L. In silico RNA isoform screening to identify potential cancer driver exons with therapeutic applications. Nat Commun 2024;15(1):7039
  19. Antonazzo G, Gaudet P, Lovering RC, Attrill H. Representation of non-coding RNA-mediated regulation of gene expression using the Gene Ontology. RNA Biol 2024;21(1):36-48
  20. Arias-Sánchez FI, Vessman B, Haym A, Alberti G, Mitri S. Artificial selection improves pollutant degradation by bacterial communities. Nat Commun 2024;15(1):7836
  21. Arribas AJ, Napoli S, Cascione L, Barnabei L, Sartori G, Cannas E, Gaudio E, Tarantelli C, Mensah AA, Spriano F, Zucchetto A, Rossi FM, Rinaldi A, Castro de Moura M, Jovic S, Bordone Pittau R, Stathis A, Stussi G, Gattei V, Brown JR, Esteller M, Zucca E, Rossi D, Bertoni F. ERBB4-Mediated Signaling Is a Mediator of Resistance to PI3K and BTK Inhibitors in B-cell Lymphoid Neoplasms. Mol Cancer Ther 2024;23(3):368-380
  22. Arribas AJ, Napoli S, Gaudio E, Herbaux C, Cannas E, Tarantelli C, Bordone-Pittau R, Cascione L, Munz N, Aresu L, Sgrignani J, Rinaldi A, Kwee I, Rossi D, Cavalli A, Zucca E, Stussi G, Stathis A, Sloss C, Davids MS, Bertoni F. PI3Kδ activation, IL-6 overexpression, and CD37 loss cause resistance to naratuximab emtansine in lymphomas. Blood Adv 2024;8(24):6268-6281
  23. Askary A, Chen W, Choi J, Du LY, Elowitz MB, Gagnon JA, Schier AF, Seidel S, Shendure J, Stadler T, Tran M. The lives of cells, recorded. Nat Rev Genet 2024
  24. Ataman M, Mittal N, Tintignac L, Schmidt A, Ham DJ, González A, Ruegg MA, Zavolan M. Calorie restriction and rapamycin distinctly mitigate aging-associated protein phosphorylation changes in mouse muscles. Commun Biol 2024;7(1):974
  25. Attafi OA, Clementel D, Kyritsis K, Capriotti E, Farrell G, Fragkouli SC, Castro LJ, Hatos A, Lenaerts T, Mazurenko S, Mozaffari S, Pradelli F, Ruch P, Savojardo C, Turina P, Zambelli F, Piovesan D, Monzon AM, Psomopoulos F, Tosatto SCE. DOME Registry: implementing community-wide recommendations for reporting supervised machine learning in biology. Gigascience2024;13:giae094
  26. Aureli S, Bellina F, Rizzi V, Gervasio FL. Investigating Ligand-Mediated Conformational Dynamics of Pre-miR21: A Machine-Learning-Aided Enhanced Sampling Study. J Chem Inf Model2024;64(22):8595-8603
  27. Auwerx C, Jõeloo M, Sadler MC, Tesio N, Ojavee S, Clark CJ, Mägi R, Estonian Biobank Research Team, Reymond A, Kutalik Z. Rare copy-number variants as modulators of common disease susceptibility. Genome Med 2024;16(1):5
  28. Auwerx C, Kutalik Z, Reymond A. The pleiotropic spectrum of proximal 16p11.2 CNVs. Am J Hum Genet 2024;111(11):2309-2346
  29. Auwerx C, Moix S, Kutalik Z, Reymond A. Disentangling mechanisms behind the pleiotropic effects of proximal 16p11.2 BP4-5 CNVs. Am J Hum Genet 2024;111(11):2347-2361
  30. Azizoglu A, Bijman EY, Stelling J, Brent R. Evolverator: An engineeredin celluloyeast system to drive rapid continuous evolution of proteins 2024
  31. Baciu-Drăgan MA, Beerenwinkel N. Oncotree2vec - a method for embedding and clustering of tumor mutation trees. Bioinformatics 2024;40(suppl 1):i180-i188
  32. Bak M, van Nimwegen E, Kouzel IU, Gur T, Schmidt R, Zavolan M, Gruber AJ. MAPP unravels frequent co-regulation of splicing and polyadenylation by RNA-binding proteins and their dysregulation in cancer. Nat Commun 2024;15(1):4110
  33. Bakker OB, Claringbould A, Westra HJ, Wiersma H, Boulogne F, Võsa U, Urzúa-Traslaviña CG, Mulcahy Symmons S, Zidan MMM, Sadler MC, Kutalik Z, Jonkers IH, Franke L, Deelen P.Identification of rare disease genes as drivers of common diseases through tissue-specific gene regulatory networks. Sci Rep 2024;14(1):30206
  34. Bao K, Silbereisen A, Grossmann J, Nanni P, Gehrig P, Emingil G, Erguz M, Karapinar DY, Pekpinarli B, Belibasakis GN, Tsilingaridis G, Zaura E, Bostanci N. Protein Network Alterations in G-CSF Treated Severe Congenital Neutropenia Patients and Beneficial Effects of Oral Health Intervention. Proteomics Clin Appl 2024;18(6):e202400064
  35. Barras D, Ghisoni E, Chiffelle J, Orcurto A, Dagher J, Fahr N, Benedetti F, Crespo I, Grimm AJ, Morotti M, Zimmermann S, Duran R, Imbimbo M, de Olza MO, Navarro B, Homicsko K, Bobisse S, Labes D, Tsourti Z, Andriakopoulou C, Herrera F, Pétremand R, Dummer R, Berthod G, Kraemer AI, Huber F, Thevenet J, Bassani-Sternberg M, Schaefer N, Prior JO, Matter M, Aedo V, Dromain C, Corria-Osorio J, Tissot S, Kandalaft LE, Gottardo R, Pittet M, Sempoux C, Michielin O, Dafni U, Trueb L, Harari A, Laniti DD, Coukos G. Response to tumor-infiltrating lymphocyte adoptive therapy is associated with preexisting CD8+ T-myeloid cell networks in melanoma. Sci Immunol 2024;9(92):eadg7995
  36. Barrat-Charlaix P, Neher RA. Eco-evolutionary dynamics of adapting pathogens and host immunity. Elife 2024;13:RP97350
  37. Baumann KBL, Mazzoli A, Salazar G, Ruscheweyh HJ, Müller B, Niederdorfer R, Sunagawa S, Lever MA, Lehmann MF, Bürgmann H. Metagenomic and -transcriptomic analyses of microbial nitrogen transformation potential, and gene expression in Swiss lake sediments. ISME Commun 2024;4(1):ycae110
  38. Baykal PI, Łabaj PP, Markowetz F, Schriml LM, Stekhoven DJ, Mangul S, Beerenwinkel N. Genomic reproducibility in the bioinformatics era. Genome Biol 2024;25(1):213
  39. Beavogui A, Lacroix A, Wiart N, Poulain J, Delmont TO, Paoli L, Wincker P, Oliveira PH. The defensome of complex bacterial communities. Nat Commun 2024;15(1):2146
  40. Bejarano L, Kauzlaric A, Lamprou E, Lourenco J, Fournier N, Ballabio M, Colotti R, Maas R, Galland S, Massara M, Soukup K, Lilja J, Brouland JP, Hottinger AF, Daniel RT, Hegi ME, Joyce JA.Interrogation of endothelial and mural cells in brain metastasis reveals key immune-regulatory mechanisms. Cancer Cell 2024;42(3):378-395.e10
  41. Beltrao P, Van Den Bossche T, Gabriels R, Holstein T, Kockmann T, Nameni A, Panse C, Schlapbach R, Lautenbacher L, Mattanovich M, Nesvizhskii A, Van Puyvelde B, Scheid J, Schwämmle V, Strauss M, Susmelj AK, The M, Webel H, Wilhelm M, Winkelhardt D, Wolski WE, Xi M. Proceedings of the EuBIC-MS developers meeting 2023. J Proteomics 2024;305:105246
  42. Beltrao P. The power of scientific collaborations and the future of structural biology. Nat Struct Mol Biol 2024;31(9):1309-1310
  43. Benvenga V, Cuénod A, Purushothaman S, Dasen G, Weisser M, Bassetti S, Roloff T, Siegemund M, Heininger U, Bielicki J, Wehrli M, Friderich P, Frei R, Widmer A, Herzog K, Fankhauser H, Nolte O, Bodmer T, Risch M, Dubuis O, Pranghofer S, Calligaris-Maibach R, Graf S, Perreten V, Seth-Smith HMB, Egli A. Historic methicillin-resistant Staphylococcus aureus: expanding current knowledge using molecular epidemiological characterization of a Swiss legacy collection. Genome Med 2024;16(1):23
  44. Bibekar P, Krapp L, Peraro MD. PeSTo-Carbs: Geometric Deep Learning for Prediction of Protein-Carbohydrate Binding Interfaces. J Chem Theory Comput 2024;20(8):2985-2991
  45. Bibert S, Quinodoz M, Perriot S, Krebs FS, Jan M, Malta RC, Collinet E, Canales M, Mathias A, Faignart N, Roulet-Perez E, Meylan P, Brouillet R, Opota O, Lozano-Calderon L, Fellmann F, Guex N, Zoete V, Asner S, Rivolta C, Du Pasquier R, Bochud PY. Herpes simplex encephalitis due to a mutation in an E3 ubiquitin ligase. Nat Commun 2024;15(1):3969
  46. Bilous M, Hérault L, Gabriel AA, Teleman M, Gfeller D. Building and analyzing metacells in single-cell genomics data. Mol Syst Biol 2024;20(7):744-766
  47. Bilous M, Hérault L, Gabriel AA, Teleman M, Gfeller D. Building and analyzing metacells in single-cell genomics data 2024
  48. Boder-Pasche S, Demir M, Heub S, Garzuel M, Ischer R, Migliozzi D, Graf S, Schmid N, Atakan HB, Gudkova D, Alpern D, Dainese R, Deplancke B, Weder G. Multi-well plate lid for single-step pooling of 96 samples for high-throughput barcode-based sequencing. Biomed Microdevices 2024;26(2):18
  49. Boersma B, Puddinu V, Huard A, Fauteux-Daniel S, Wirapati P, Guedri S, Tille JC, McKee T, Pittet M, Palmer G, Bourquin C. GSDMD is associated with survival in human breast cancer but does not impact anti-tumor immunity in a mouse breast cancer model. Front Immunol 2024;15:1396777
  50. Bontonou G, Saint-Leandre B, Kafle T, Baticle T, Hassan A, Sánchez-Alcañiz JA, Arguello JR. Evolution of chemosensory tissues and cells across ecologically diverse Drosophilids. Nat Commun 2024;15(1):1047
  51. Borsatto A, Gianquinto E, Rizzi V, Gervasio FL. SWISH-X, an Expanded Approach to Detect Cryptic Pockets in Proteins and at Protein-Protein Interfaces. J Chem Theory Comput2024;20(8):3335-3348
  52. Bourguignon L, Lukas LP, Guest JD, Geisler FH, Noonan V, Curt A, Brüningk SC, Jutzeler CR. Studying missingness in spinal cord injury data: challenges and impact of data imputation. BMC Med Res Methodol 2024;24(1):5
  53. Bourguignon L, Lukas LP, Kondiles BR, Tong B, Lee JJ, Gomes T, Tetzlaff W, Kramer JLK, Walter M, Jutzeler CR. Impact of commonly administered drugs on the progression of spinal cord injury: a systematic review. Commun Med (Lond) 2024;4(1):213
  54. Bozzi D, Neuenschwander S, Cruz Dávalos DI, Sousa da Mota B, Schroeder H, Moreno-Mayar JV, Allentoft ME, Malaspinas AS. Towards predicting the geographical origin of ancient samples with metagenomic data. Sci Rep 2024;14(1):21794
  55. Brewer TE, Wagner A. Horizontal Gene Transfer of a key Translation Factor and its Role in Polyproline Proteome Evolution. Mol Biol Evol 2024;41(9):msae180
  56. Bruschi M, Angeletti A, Prunotto M, Meroni PL, Ghiggeri GM, Zeus consortium, Moroni G, Sinico RA, Franceschini F, Fredi M, Vaglio A, Cavalli A, Scapozza L, Patel JJ, Tan JC, Lo KC, Cavagna L, Petretto A, Pratesi F, Migliorini P, Locatelli F, Pazzola G, Pesce G, Giannese D, Manfredi A, Ramirez GA, Esposito P, Murdaca G, Negrini S, Bui F, Trezzi B, Emmi G, Cavazzana I, Binda V, Fenaroli P, Pisan I, Montecucco C, Santoro D, Scolari F, Mescia F, Volpi S, Mosca M, Tincani A, Ravelli A, Murtas C, Candiano G, Caridi G, La Porta E, Verrina E. A critical view on autoantibodies in lupus nephritis: Concrete knowledge based on evidence. Autoimmun Rev 2024;23(5):103535
  57. Brümmer A, Bergmann S. Disentangling genetic effects on transcriptional and post-transcriptional gene regulation through integrating exon and intron expression QTLs. Nat Commun2024;15(1):3786
  58. Brüningk SC, Bourguignon L, Lukas LP, EMSCI study group, Maier D, Abel R, Weidner N, Rupp R, Geisler F, Kramer JLK, Guest J, Curt A, Jutzeler CR. Prediction of segmental motor outcomes in traumatic spinal cord injury: Advances beyond sum scores. Exp Neurol 2024;380:114905
  59. Bugnon M, Röhrig UF, Goullieux M, Perez MAS, Daina A, Michielin O, Zoete V. SwissDock 2024: major enhancements for small-molecule docking with Attracting Cavities and AutoDock Vina.Nucleic Acids Res 2024;52(w1):W324-W332
  60. Burgermeister S, Stoykova S, Krebs F, Zoete V, Mbefo M, Egervari K, Reinhard A, Bisig B, Hewer E. Methylation-Based Characterization of a New IDH2 Mutation in Sinonasal Undifferentiated Carcinoma Int J Mol Sci 2024;25(12)
  61. Burgermeister S, Stoykova S, Krebs FS, Zoete V, Mbefo M, Egervari K, Reinhard A, Bisig B, Hewer E. Methylation-Based Characterization of a New IDH2 Mutation in Sinonasal Undifferentiated Carcinoma. Int J Mol Sci 2024;25(12):6518
  62. Cacciatore A, Shinde D, Musumeci C, Sandrini G, Guarrera L, Albino D, Civenni G, Storelli E, Mosole S, Federici E, Fusina A, Iozzo M, Rinaldi A, Pecoraro M, Geiger R, Bolis M, Catapano CV, Carbone GM. Epigenome-wide impact of MAT2A sustains the androgen-indifferent state and confers synthetic vulnerability in ERG fusion-positive prostate cancer. Nat Commun2024;15(1):6672
  63. Caduff M, Eckel R, Leuenberger C, Wegmann D. Accurate Bayesian inference of sex chromosome karyotypes and sex-linked scaffolds from low-depth sequencing data. Mol Ecol Resour2024;24(3):e13913
  64. Cai P, Robinson MD, Tiberi S. DESpace: spatially variable gene detection via differential expression testing of spatial clusters. Bioinformatics 2024;40(2):btae027
  65. Cailleau G, Junier T, Paul C, Fatton M, Corona-Ramirez A, Gning O, Beck K, Vidal J, Bürgmann H, Junier P. Temporal and spatial changes in the abundance of antibiotic resistance gene markers in a wastewater treatment plant. Water Environ Res 2024;96(8):e11104
  66. Calderón Del Cid C, Villalobos F, Dobrovolski R, Carrillo JD, Silvestro D, Vilela B. The Clade Replacement Theory: a framework to study age-dependent extinction. J Evol Biol 2024;37(3):290-301
  67. Callahan TJ, Tripodi IJ, Stefanski AL, Cappelletti L, Taneja SB, Wyrwa JM, Casiraghi E, Matentzoglu NA, Reese J, Silverstein JC, Hoyt CT, Boyce RD, Malec SA, Unni DR, Joachimiak MP, Robinson PN, Mungall CJ, Cavalleri E, Fontana T, Valentini G, Mesiti M, Gillenwater LA, Santangelo B, Vasilevsky NA, Hoehndorf R, Bennett TD, Ryan PB, Hripcsak G, Kahn MG, Bada M, Baumgartner WA, Hunter LE. An open source knowledge graph ecosystem for the life sciences. Sci Data 2024;11(1):363
  68. Calore F, Casadei L, Sarchet PD, Fadda P, Nigita G, Coombes KR, Cascione L, Costas C de Faria F, Tahara S, Iwenofu OH, Pollock RE, Grignol VP. Extracellular Vesicle - MDM2-DNA as a Potential Liquid Biopsy Biomarker for Disease Identification in Retroperitoneal Liposarcoma. Ann Surg 2024
  69. Campese L, Russo L, Abagnale M, Alberti A, Bachi G, Balestra C, Bellardini D, Buondonno A, Cardini U, Carotenuto Y, Checcucci G, Chiusano ML, D'Ambra I, d'Ippolito G, Di Capua I, Donnarumma V, Fontana A, Furia M, Galarza-Verkovitch D, Gallia R, Labadie K, Leone S, Licandro P, Longo A, Maselli M, Merquiol L, Murano C, Oliveira PH, Passarelli A, Percopo I, Perdereau A, Piredda R, Raffini F, Roncalli V, Ruscheweyh HJ, Russo E, Saggiomo M, Santinelli C, Sarno D, Sunagawa S, Tramontano F, Trano AC, Uttieri M, Wincker P, Zampicinini G, Casotti R, Conversano F, D'Alelio D, Iudicone D, Margiotta F, Montresor M. The NEREA Augmented Observatory: an integrative approach to marine coastal ecology. Sci Data 2024;11(1):989
  70. Campli G, Volovych O, Kim K, Veldsman WP, Drage HB, Sheizaf I, Lynch S, Chipman AD, Daley AC, Robinson-Rechavi M, Waterhouse RM. The moulting arthropod: a complete genetic toolkit review. Biol Rev Camb Philos Soc 2024;99(6):2338-2375
  71. Carlin M, Kaur J, Ciobanu DZ, Song Z, Olsson M, Totu T, Gupta G, Peng G, González VJ, Janica I, Pozo VF, Chortarea S, Buljan M, Buerki-Thurnherr T, Rio Castillo AED, Thorat SB, Bonaccorso F, Tubaro A, Vazquez E, Prato M, Armirotti A, Wick P, Bianco A, Fadeel B, Pelin M. Hazard assessment of hexagonal boron nitride and hexagonal boron nitride reinforced thermoplastic polyurethane composites using human skin and lung cells. J Hazard Mater 2024;473:134686
  72. Carnegie L, McCrone JT, du Plessis L, Hasan M, Ali MZ, Begum R, Hassan MZ, Islam S, Rahman MH, Uddin ASM, Sarker MS, Das T, Hossain M, Khan M, Razu MH, Akram A, Arina S, Hoque E, Molla MMA, Nafisaa T, Angra P, Rambaut A, Pullan ST, Osman KL, Hoque MA, Biswas P, Flora MS, Raghwani J, Fournié G, Samad MA, Hill SC. Genomic epidemiology of early SARS-CoV-2 transmission dynamics in Bangladesh. Virol J 2024;21(1):291
  73. Castillo-Armengol J, Marzetta F, Sanchez-Archidona AR, Fledelius C, Evans M, McNeilly A, McCrimmon RJ, Ibberson M, Thorens B. Correction to: Disrupted hypothalamic transcriptomics and proteomics in a mouse model of type 2 diabetes exposed to recurrent hypoglycaemia. Diabetologia 2024;67(2):403
  74. Cavinato T, Rubinacci S, Malaspinas AS, Delaneau O. A resampling-based approach to share reference panels. Nat Comput Sci 2024;4(5):360-366
  75. Cervia-Hasler C, Brüningk SC, Hoch T, Fan B, Muzio G, Thompson RC, Ceglarek L, Meledin R, Westermann P, Emmenegger M, Taeschler P, Zurbuchen Y, Pons M, Menges D, Ballouz T, Cervia-Hasler S, Adamo S, Merad M, Charney AW, Puhan M, Brodin P, Nilsson J, Aguzzi A, Raeber ME, Messner CB, Beckmann ND, Borgwardt K, Boyman O. Persistent complement dysregulation with signs of thromboinflammation in active Long Covid. Science 2024;383(6680):eadg7942
  76. Chan T, Ginders J, Kuhlmeier E, Meli ML, Bönzli E, Meili T, Hüttl J, Hatt JM, Hindenlang Clerc K, Kipar A, Wyss F, Wenker C, Ryser-Degiorgis MP, Valenzuela Agüí C, Urban C, Beisel C, Stadler T, Hofmann-Lehmann R. Detection of SARS-CoV-2 RNA in a Zoo-Kept Red Fox (Vulpes vulpes). Viruses 2024;16(4):521
  77. Chaparro-Pedraza PC, Roth G, Melián CJ. Ecological diversification in sexual and asexual lineages. Sci Rep 2024;14(1):30369
  78. Chaparro-Pedraza PC. Evolution alters ecological resilience. Nat Ecol Evol 2024;8(12):2155-2156
  79. Chatelain FC, Gilbert N, Bichet D, Jauch A, Feliciangeli S, Lesage F, Bignucolo O. Mechanistic basis of the dynamic response of TWIK1 ionic selectivity to pH. Nat Commun 2024;15(1):3849
  80. Chen Z, Tsui JL, Gutierrez B, Busch Moreno S, du Plessis L, Deng X, Cai J, Bajaj S, Suchard MA, Pybus OG, Lemey P, Kraemer MUG, Yu H. COVID-19 pandemic interventions reshaped the global dispersal of seasonal influenza viruses. Science 2024;386(6722):eadq3003
  81. Cherrak Y, Salazar MA, Näpflin N, Malfertheiner L, Herzog MK, Schubert C, von Mering C, Hardt WD. Non-canonical start codons confer context-dependent advantages in carbohydrate utilization for commensal E. coli in the murine gut. Nat Microbiol 2024;9(10):2696-2709
  82. Choi DC, Messali N, Uda NR, Abu-Zeinah G, Kermani P, Yabut MM, Lischer HEL, Castillo Tokumori F, Erdos K, Lehmann T, Sobas M, Rao TN, Scandura JM. JAK2<sup>V617F</sup> impairs lymphoid differentiation in myeloproliferative neoplasms. Leukemia 2024;38(11):2487-2491
  83. Chong AY, Brenner N, Jimenez-Kaufmann A, Cortes A, Hill M, Littlejohns TJ, Gilchrist JJ, Fairfax BP, Knight JC, Hodel F, Fellay J, McVean G, Moreno-Estrada A, Waterboer T, Hill AVS, Mentzer AJ. A common NFKB1 variant detected through antibody analysis in UK Biobank predicts risk of infection and allergy. Am J Hum Genet 2024;111(2):295-308
  84. Christinat Y, Hamelin B, Alborelli I, Angelino P, Barbié V, Bisig B, Dawson H, Frattini M, Grob T, Jochum W, Nienhold R, McKee T, Matter M, Missiaglia E, Molinari F, Rothschild S, Sobottka-Brillout AB, Vassella E, Zoche M, Mertz KD. Reporting of somatic variants in clinical cancer care: recommendations of the Swiss Society of Molecular Pathology. Virchows Arch2024;485(6):1033-1039
  85. Cina A, Vitale J, Haschtmann D, Loibl M, Fekete TF, Kleinstück F, Galbusera F, Jutzeler CR, Mannion AF. Methodological considerations in calculating the minimal clinically important change score for the core outcome measures index (COMI): insights from a large single-centre spine surgery registry. Eur Spine J 2024;33(12):4415-4425
  86. Clúa J, Jaskolowski A, Abriata LA, Poirier Y. Spotlight on cytochrome b561 and DOMON domain proteins. Trends Plant Sci 2024:S1360-1385(24)00308-X
  87. Coelho R, Seashore-Ludlow B, Schütz S, Lombardo Christopher F, Moussaud-Lamodière E, Casanova R, Ficek-Pascual J, Labrosse Brunhilde K, Lopez-Nunez M, Rimmer N, Fedier A, Lima R, Montavon Sartorius C, Kurzeder C, Singer F, Bertolini A, Tumor Profiler Consortium, Rätsch G, Bodenmiller B, Kallioniemi O, Östling P, David L, Heinzelmann-Schwarz V, Jacob F. SMAC mimetics overcome apoptotic resistance in ovarian cancer through MSLN-TNF alpha axis 2024
  88. Colucci M, Zumerle S, Bressan S, Gianfanti F, Troiani M, Valdata A, D'Ambrosio M, Pasquini E, Varesi A, Cogo F, Mosole S, Dongilli C, Desbats MA, Contu L, Revankdar A, Chen J, Kalathur M, Perciato ML, Basilotta R, Endre L, Schauer S, Othman A, Guccini I, Saponaro M, Maraccani L, Bancaro N, Lai P, Liu L, Pernigoni N, Mele F, Merler S, Trotman LC, Guarda G, Calì B, Montopoli M, Alimonti A. Retinoic acid receptor activation reprograms senescence response and enhances anti-tumor activity of natural killer cells. Cancer Cell 2024;42(4):646-661.e9
  89. Conforti S, Holschneider A, Sylvestre É, Sylvestre É, Julian TR. Monitoring ESBL-Escherichia coli in Swiss wastewater between November 2021 and November 2022: insights into population carriage. mSphere 2024;9(5):e0076023
  90. Cooper RB, Flannery-Sutherland JT, Silvestro D. DeepDive: estimating global biodiversity patterns through time using deep learning. Nat Commun 2024;15(1):4199
  91. Correa Marrero M, Jänes J, Baptista D, Beltrao P. Integrating Large-Scale Protein Structure Prediction into Human Genetics Research. Annu Rev Genomics Hum Genet 2024;25(1):123-140
  92. Croce G, Bobisse S, Moreno DL, Schmidt J, Guillame P, Harari A, Gfeller D. Deep learning predictions of TCR-epitope interactions reveal epitope-specific chains in dual alpha T cells. Nat Commun 2024;15(1):3211
  93. Crouzet SJ, Lieberherr AM, Atz K, Nilsson T, Sach-Peltason L, Müller AT, Dal Peraro M, Zhang JD. G-PLIP: Knowledge graph neural network for structure-free protein-ligand bioactivity prediction. Comput Struct Biotechnol J 2024;23:2872-2882
  94. Crowell HL, Leonardo SXM, Soneson C, Robinson MD. Author Correction: The shaky foundations of simulating single-cell RNA sequencing data. Genome Biol 2024;25(1):178
  95. Csepregi L, Hoehn K, Neumeier D, Taft JM, Friedensohn S, Weber CR, Kummer A, Sesterhenn F, Correia BE, Reddy ST. The physiological landscape and specificity of antibody repertoires are consolidated by multiple immunizations. Elife 2024;13:e92718
  96. Cumer T, Machado AP, San-Jose LM, Ducrest AL, Simon C, Roulin A, Goudet J. The genomic architecture of continuous plumage colour variation in the European barn owl (Tyto alba). Proc Biol Sci 2024;291(2014):20231995
  97. D'Anna F, Jareborg N, Jetten M, Ahokas M, Alper P, Andrews R, Bösl K, D'Altri T, Faria D, Fatima N, Fuchs S, Garrard C, Gu W, Heil KF, Kallberg Y, Licciulli F, Lübke NC, Melo AMP, Mičetić I, Oliveira J, Oulas A, Palagi PM, Poterlowicz K, Perez-Sitja X, Ruch P, Sansone SA, Schnitzer H, van Gelder C, Vergoulis T, Wibberg D, Wittig U, Leskošek B, Vondrasek J, Andrabi M. A research data management (RDM) community for ELIXIR. F1000Res 2024;13:ELIXIR-230
  98. Dabrowski-Tumanski P, Goundaroulis D, Stasiak A, Rawdon EJ, Sulkowska JI. Theta-curves in proteins. Protein Sci 2024;33(9):e5133
  99. Dagenais P, Jahanbakhsh E, Capitan A, Jammes H, Reynaud K, De Juan Romero C, Borrell V, Milinkovitch MC. Mechanical positional information guides the self-organized development of a polygonal network of creases in the skin of mammalian noses. Curr Biol 2024;34(22):5197-5212.e4
  100. Daina A, Zoete V. Testing the predictive power of reverse screening to infer drug targets, with the help of machine learning. Commun Chem 2024;7(1):105
  101. Darlix A, Bady P, Deverdun J, Lefort K, Rigau V, Le Bars E, Meriadec J, Carrière M, Coget A, Santarius T, Matys T, Duffau H, Hegi ME. Clinical value of the <i>MGMT</i> promoter methylation score in IDHmt low-grade glioma for predicting benefit from temozolomide treatment. Neurooncol Adv 2025;7(1):vdae224
  102. Darrous L, Hemani G, Davey Smith G, Kutalik Z. PheWAS-based clustering of Mendelian Randomisation instruments reveals distinct mechanism-specific causal effects between obesity and educational attainment. Nat Commun 2024;15(1):1420
  103. Dasmeh P, Zheng J, Erdoğan AN, Tokuriki N, Wagner A. Rapid evolutionary change in trait correlations of single proteins. Nat Commun 2024;15(1):3327
  104. De Castro E, Hulo C, Masson P, Auchincloss A, Bridge A, Le Mercier P. ViralZone 2024 provides higher-resolution images and advanced virus-specific resources. Nucleic Acids Res2024;52(d1):D817-D821
  105. Del Cid CC, Hauffe T, Carrillo JD, May MR, Warnock RCM, Silvestro D. Challenges in estimating species' age from phylogenetic trees. Glob Ecol Biogeogr 2024;33(10):e13890
  106. Delacrétaz A, Sadler M, Gamma F, Preisig M, Richard-Lepouriel H, von Gunten A, Conus P, Plessen KJ, Kutalik Z, Eap CB. Lipid disturbances induced by psychotropic drugs: clinical and genetic predictors for early worsening of lipid levels and new-onset dyslipidaemia in Swiss psychiatric samples. BJPsych Open 2024;10(6):e227
  107. Delfin C, Dragan I, Kuznetsov D, Tajes JF, Smit F, Coral DE, Farzaneh A, Haugg A, Hungele A, Niknejad A, Hall C, Jacobs D, Marek D, Fraser DP, Thuillier D, Ahmadizar F, Mehl F, Pattou F, Burdet F, Hawkes G, Arts ICW, Blanch J, Van Soest J, Fernández-Real JM, Boehl J, Fink K, van Greevenbroek MMJ, Kavousi M, Minten M, Prinz N, Ipsen N, Franks PW, Ramos R, Holl RW, Horban S, Duarte-Salles T, Tran VDT, Raverdy V, Leal Y, Lenart A, Pearson E, Sparsø T, Giordano GN, Ioannidis V, Soh K, Frayling TM, Le Roux CW, Ibberson M. A Federated Database for Obesity Research: An IMI-SOPHIA Study. Life (Basel) 2024;14(2):262
  108. Dennstädt F, Zink J, Putora PM, Hastings J, Cihoric N. Title and abstract screening for literature reviews using large language models: an exploratory study in the biomedical domain. Syst Rev2024;13(1):158
  109. Dessimoz C, Thomas PD. AI and the democratization of knowledge. Sci Data 2024;11(1):268
  110. Dietler N, Abbara A, Choudhury S, Bitbol AF. Impact of phylogeny on the inference of functional sectors from protein sequence data. PLoS Comput Biol 2024;20(9):e1012091
  111. Ding X, Aureli S, Vaithia A, Lavriha P, Schuster D, Khanppnavar B, Li X, Blum TB, Picotti P, Gervasio FL, Korkhov VM. Structural basis of connexin-36 gap junction channel inhibition. Cell Discov 2024;10(1):68
  112. Dlamini Z, Ladomery MR, Kahraman A. Editorial: The RNA revolution and cancer. Front Endocrinol (Lausanne) 2024;15:1422599
  113. Dmitrijeva M, Tackmann J, Matias Rodrigues JF, Huerta-Cepas J, Coelho LP, von Mering C. A global survey of prokaryotic genomes reveals the eco-evolutionary pressures driving horizontal gene transfer. Nat Ecol Evol 2024;8(5):986-998
  114. Dong Y, Gottardo R. An approach for integrating multimodal omics data into sparse and interpretable models. Cell Rep Methods 2024;4(2):100718
  115. Donnelly C, Komlódi T, Cecatto C, Cardoso LHD, Compagnion AC, Matera A, Tavernari D, Campiche O, Paolicelli RC, Zanou N, Kayser B, Gnaiger E, Place N. Functional hypoxia reduces mitochondrial calcium uptake. Redox Biol 2024;71:103037
  116. Dubath C, Porcu E, Delacrétaz A, Grosu C, Laaboub N, Piras M, von Gunten A, Conus P, Plessen KJ, Kutalik Z, Eap CB. DNA methylation may partly explain psychotropic drug-induced metabolic side effects: results from a prospective 1-month observational study. Clin Epigenetics 2024;16(1):36
  117. Dugershaw-Kurzer B, Bossart J, Buljan M, Hannig Y, Zehnder S, Gupta G, Kissling VM, Nowak-Sliwinska P, van Beijnum JR, Griffioen AW, Masjosthusmann S, Zühr E, Fritsche E, Hornung R, Rduch T, Buerki-Thurnherr T. Nanoparticles Dysregulate the Human Placental Secretome with Consequences on Angiogenesis and Vascularization. Adv Sci (Weinh) 2024;11(28):e2401060
  118. Durairaj J, Follonier OM, Leuzinger K, Alexander LT, Wilhelm M, Pereira J, Hillenbrand CA, Weissbach FH, Schwede T, Hirsch HH. Structural implications of BK polyomavirus sequence variations in the major viral capsid protein Vp1 and large T-antigen: a computational study. mSphere 2024;9(4):e0079923
  119. Dwarshuis N, Kalra D, McDaniel J, Sanio P, Alvarez Jerez P, Jadhav B, Huang WE, Mondal R, Busby B, Olson ND, Sedlazeck FJ, Wagner J, Majidian S, Zook JM. The GIAB genomic stratifications resource for human reference genomes. Nat Commun 2024;15(1):9029
  120. Dyrdak R, Hodcroft EB, Broddesson S, Grabbe M, Franklin H, Gisslén M, Holm ME, Lindh M, Nederby-Öhd J, Ringlander J, Sundqvist M, Neher RA, Albert J. Early unrecognised SARS-CoV-2 introductions shaped the first pandemic wave, Sweden, 2020. Euro Surveill 2024;29(41)
  121. Dörig C, Marulli C, Peskett T, Volkmar N, Pantolini L, Studer G, Paleari C, Frommelt F, Schwede T, de Souza N, Barral Y, Picotti P. Global profiling of protein complex dynamics with an experimental library of protein interaction markers. Nat Biotechnol 2024
  122. Edalat SG, Gerber R, Houtman M, Lückgen J, Teixeira RL, Palacios Cisneros MDP, Pfanner T, Kuret T, Ižanc N, Micheroli R, Polido-Pereira J, Saraiva F, Lingam S, Burki K, Burja B, Pauli C, Rotar Ž, Tomšič M, Čučnik S, Fonseca JE, Distler O, Calado Â, Romão VC, Ospelt C, Sodin-Semrl S, Robinson MD, Frank Bertoncelj M. Molecular maps of synovial cells in inflammatory arthritis using an optimized synovial tissue dissociation protocol. iScience 2024;27(6):109707
  123. Egger M, Sauermann M, Loosli T, Hossmann S, Riedo S, Beerenwinkel N, Jaquet A, Minga A, Ross JL, Giandhari J, Kouyos R, Lessells R. HIV-1 subtype-specific drug resistance on dolutegravir-based antiretroviral therapy: protocol for a multicentre longitudinal study (DTG RESIST) 2024
  124. Erdil E, Becker AS, Schwyzer M, Martinez-Tellez B, Ruiz JR, Sartoretti T, Vargas HA, Burger AI, Chirindel A, Wild D, Zamboni N, Deplancke B, Gardeux V, Maushart CI, Betz MJ, Wolfrum C, Konukoglu E. Predicting standardized uptake value of brown adipose tissue from CT scans using convolutional neural networks. Nat Commun 2024;15(1):8402
  125. Erdil E, Becker AS, Schwyzer M, Martinez-Tellez B, Ruiz JR, Sartoretti T, Vargas HA, Burger AI, Chirindel A, Wild D, Zamboni N, Deplancke B, Gardeux V, Maushart CI, Betz MJ, Wolfrum C, Konukoglu E. Author Correction: Predicting standardized uptake value of brown adipose tissue from CT scans using convolutional neural networks. Nat Commun 2024;15(1):10022
  126. Falcetta D, Quirim S, Cocchiararo I, Chabry F, Théodore M, Stiefvater A, Lin S, Tintignac L, Ivanek R, Kinter J, Rüegg MA, Sinnreich M, Castets P. CaMKIIβ deregulation contributes to neuromuscular junction destabilization in Myotonic Dystrophy type I. Skelet Muscle 2024;14(1):11
  127. Fang T, Szklarczyk D, Hachilif R, von Mering C. Enhancing coevolutionary signals in protein-protein interaction prediction through clade-wise alignment integration. Sci Rep 2024;14(1):6009
  128. Faurby S, Silvestro D, Werdelin L, Antonelli A. Reliable biogeography requires fossils: insights from a new species-level phylogeny of extinct and living carnivores. Proc Biol Sci2024;291(2028):20240473
  129. Fellmann F, Saunders C, O'Donohue MF, Reid DW, McFadden KA, Montel-Lehry N, Yu C, Fang M, Zhang J, Royer-Bertrand B, Farinelli P, Karboul N, Willer JR, Fievet L, Bhuiyan ZA, Kleinhenz AL, Jadeau J, Fulbright J, Rivolta C, Renella R, Katsanis N, Beckmann JS, Nicchitta CV, Da Costa L, Davis EE, Gleizes PE. An atypical form of 60S ribosomal subunit in Diamond-Blackfan anemia linked to RPL17 variants. JCI Insight 2024;9(17):e172475
  130. Feng M, Robinson S, Qi W, Edwards A, Stierli B, van der Heijden M, Frey B, Varliero G. Microbial genetic potential differs among cryospheric habitats of the Damma glacier. Microb Genom2024;10(10)
  131. Ferreira GS, Nascimento ER, Cadena EA, Cozzuol MA, Farina BM, Pacheco MLAF, Rizzutto MA, Langer MC. The latest freshwater giants: a new Peltocephalus (Pleurodira: Podocnemididae) turtle from the Late Pleistocene of the Brazilian Amazon. Biol Lett 2024;20(3):20240010
  132. Ferreira GS, Nascimento ER, Cadena EA, Cozzuol MA, Farina BM, Pacheco MLAF, Rizzutto MA, Langer MC. Correction: 'The latest freshwater giants: a new Peltocephalus (Pleurodira: Podocnemididae) turtle from the Late Pleistocene of the Brazilian Amazon' (2024), by Ferreira et al. Biol Lett 2024;20(6):20240151
  133. Ferreira HJ, Stevenson BJ, Pak H, Yu F, Almeida Oliveira J, Huber F, Taillandier-Coindard M, Michaux J, Ricart-Altimiras E, Kraemer AI, Kandalaft LE, Speiser DE, Nesvizhskii AI, Müller M, Bassani-Sternberg M. Immunopeptidomics-based identification of naturally presented non-canonical circRNA-derived peptides. Nat Commun 2024;15(1):2357
  134. Ferrero R, Rainer PY, Rumpler M, Russeil J, Zachara M, Pezoldt J, van Mierlo G, Gardeux V, Saelens W, Alpern D, Favre L, Vionnet N, Mantziari S, Zingg T, Pitteloud N, Suter M, Matter M, Schlaudraff KU, Canto C, Deplancke B. A human omentum-specific mesothelial-like stromal population inhibits adipogenesis through IGFBP2 secretion. Cell Metab 2024;36(7):1566-1585.e9
  135. Feuermann M, Gaudet P. Interpreting Gene Ontology Annotations Derived from Sequence Homology Methods. Methods Mol Biol 2024;2836:285-298
  136. Fogarty EC, Schechter MS, Lolans K, Sheahan ML, Veseli I, Moore RM, Kiefl E, Moody T, Rice PA, Yu MK, Mimee M, Chang EB, Ruscheweyh HJ, Sunagawa S, Mclellan SL, Willis AD, Comstock LE, Eren AM. A cryptic plasmid is among the most numerous genetic elements in the human gut. Cell 2024;187(5):1206-1222.e16
  137. Forrer P, Palianina D, Stühler C, Kreuzaler M, Roux J, Li J, Schmutz C, Burckhardt D, Franzeck F, Finke D, Schmidt A, Bumann D, Khanna N. Unveiling signaling pathways inducing MHC class II expression in neutrophils. Front Immunol 2024;15:1444558
  138. Fournier M, Javary J, Roh V, Fournier N, Radtke F. Reciprocal inhibition of NOTCH and SOX2 shapes tumor cell plasticity and therapeutic escape in triple-negative breast cancer. EMBO Mol Med 2024;16(12):3184-3217
  139. Frey B, Aiesi M, Rast BM, Rüthi J, Julmi J, Stierli B, Qi W, Brunner I. Searching for new plastic-degrading enzymes from the plastisphere of alpine soils using a metagenomic mining approach.PLoS One 2024;19(4):e0300503
  140. Fromont LA, Moldes M, Baudis M, Brookes AJ, Navarro A, Rambla J. Twelve quick tips for deploying a Beacon. PLoS Comput Biol 2024;20(3):e1011817
  141. Fröhlking T, Bonati L, Rizzi V, Gervasio FL. Deep learning path-like collective variable for enhanced sampling molecular dynamics. J Chem Phys 2024;160(17):174109
  142. Fröhlking T, Rizzi V, Aureli S, Gervasio FL. DeepLNE++ leveraging knowledge distillation for accelerated multi-state path-like collective variables. J Chem Phys 2024;161(11):114102
  143. Fuhrmann L, Jablonski KP, Topolsky I, Batavia AA, Borgsmüller N, Baykal PI, Carrara M, Chen C, Dondi A, Dragan M, Dreifuss D, John A, Langer B, Okoniewski M, du Plessis L, Schmitt U, Singer F, Stadler T, Beerenwinkel N. V-pipe 3.0: a sustainable pipeline for within-sample viral genetic diversity estimation. Gigascience 2024;13:giae065
  144. Fuhrmann L, Langer B, Topolsky I, Beerenwinkel N. VILOCA: sequencing quality-aware viral haplotype reconstruction and mutation calling for short-read and long-read data. NAR Genom Bioinform 2024;6(4):lqae152
  145. Fuqua T, Sun Y, Wagner A. The emergence and evolution of gene expression in genome regions replete with regulatory motifs. Elife 2024;13:RP98654
  146. Gaboriau T, Tobias JA, Silvestro D, Salamin N. Exploring the Macroevolutionary Signature of Asymmetric Inheritance at Speciation. Syst Biol 2024:syae043
  147. Gabriel AA, Racle J, Falquet M, Jandus C, Gfeller D. Robust estimation of cancer and immune cell-type proportions from bulk tumor ATAC-Seq data. Elife 2024;13:RP94833
  148. Garaud L, Nusbaumer D, Marques da Cunha L, de Guttry C, Ançay L, Atherton A, Lasne E, Wedekind C. Parental kinship coefficient but not paternal coloration predicts early offspring growth in lake char. Heredity (Edinb) 2024;132(5):247-256
  149. Gardeux V, Bevers RPJ, David FPA, Rosschaert E, Rochepeau R, Deplancke B. DGRPool, a web tool leveraging harmonized <i>Drosophila</i> Genetic Reference Panel phenotyping data for the study of complex traits. Elife 2024;12:RP88981
  150. Garrido Marques A, Rubinacci S, Malaspinas AS, Delaneau O, Sousa da Mota B. Assessing the impact of post-mortem damage and contamination on imputation performance in ancient DNA.Sci Rep 2024;14(1):6227
  151. Garrido-Trigo A, Corraliza AM, Veny M, Dotti I, Melón-Ardanaz E, Rill A, Crowell HL, Corbí Á, Gudiño V, Esteller M, Álvarez-Teubel I, Aguilar D, Masamunt MC, Killingbeck E, Kim Y, Leon M, Visvanathan S, Marchese D, Caratù G, Martin-Cardona A, Esteve M, Ordás I, Panés J, Ricart E, Mereu E, Heyn H, Salas A. Author Correction: Macrophage and neutrophil heterogeneity at single-cell spatial resolution in human inflammatory bowel disease. Nat Commun 2024;15(1):857
  152. Gaudry A, Pagni M, Mehl F, Moretti S, Quiros-Guerrero LM, Cappelletti L, Rutz A, Kaiser M, Marcourt L, Queiroz EF, Ioset JR, Grondin A, David B, Wolfender JL, Allard PM. A Sample-Centric and Knowledge-Driven Computational Framework for Natural Products Drug Discovery. ACS Cent Sci 2024;10(3):494-510
  153. Gayer M, Xu ZM, Hodel F, Preisig M, Strippoli MF, Vollenweider P, Vaucher J, Lutti A, Kherif F, Penner IK, Du Pasquier R, Fellay J, Draganski B. EBNA-1 and VCA-p18 immunoglobulin markers link Epstein-Barr virus immune response and brain's myelin content to fatigue in a community-dwelling cohort. Brain Behav Immun Health 2024;42:100896
  154. Gayet-Ageron A, Ben Messaoud K, Richards M, Jaksic C, Gobeill J, Liyanapathirana J, Mottin L, Naderi N, Ruch P, Mariot Z, Calmy A, Friedman J, Leibovici L, Schroter S. Gender and geographical bias in the editorial decision-making process of biomedical journals: a case-control study. BMJ Evid Based Med 2024:bmjebm-2024-113083
  155. Genoud V, Dutoit V, Thang NT, Janowczyk A, McKee T, Chalandon Y, Tsantoulis P, Dietrich PY. Neoantigen-specific T-cell response after donor lymphocyte infusion associates with favorable outcome in a patient with i(12p) germ cell tumor, acute leukemia and sarcoma of the same clonal origin. Haematologica 2024;109(7):2364-2367
  156. Gerbaldo FE, Sonder E, Fischer V, Frei S, Wang J, Gapp K, Robinson MD, Germain PL. On the identification of differentially-active transcription factors from ATAC-seq data. PLoS Comput Biol2024;20(10):e1011971
  157. Germuskova Z, Sosa E, Lagos AC, Aamot HV, Beale MA, Bertelli C, Björkmann J, Couto N, Feige L, Greub G, Hallbäck ET, Hodcroft EB, Harmsen D, Jacob L, Jolley KA, Kahles A, Mather AE, Neher RA, Neves A, Niemann S, Nolte O, Peacock SJ, Razavi M, Roloff T, Schrenzel J, Sikora P, Sundqvist M, Mölling P, Egli A. Conference report: the first bacterial genome sequencing pan-European network conference. Microbes Infect 2024;26(8):105410
  158. Giordano Attianese GMP, Shui S, Cribioli E, Triboulet M, Scheller L, Hafezi M, Reichenbach P, Gainza P, Georgeon S, Correia BE, Irving M. Dual ON/OFF-switch chimeric antigen receptor controlled by two clinically approved drugs. Proc Natl Acad Sci U S A 2024;121(44):e2405085121
  159. Glauer M, Neuhaus F, Flügel S, Wosny M, Mossakowski T, Memariani A, Schwerdt J, Hastings J. Chebifier: automating semantic classification in ChEBI to accelerate data-driven discovery.Digit Discov 2024;3(5):896-907
  160. Gloyn AL, Ibberson M, Marchetti P, Powers AC, Rorsman P, Sander M, Solimena M. Author Correction: Every islet matters: improving the impact of human islet research. Nat Metab2024;6(7):1415
  161. Goetze S, van Drogen A, Albinus JB, Fort KL, Gandhi T, Robbiani D, Laforte V, Reiter L, Levesque MP, Xuan Y, Wollscheid B. Simultaneous targeted and discovery-driven clinical proteotyping using hybrid-PRM/DIA. Clin Proteomics 2024;21(1):26
  162. Gollub MG, Backes T, Kaltenbach HM, Stelling J. ENKIE: a package for predicting enzyme kinetic parameter values and their uncertainties. Bioinformatics 2024;40(11):btae652
  163. Gouy A, Wang X, Kapopoulou A, Neuenschwander S, Schmid E, Excoffier L, Heckel G. Genomes of Microtus Rodents Highlight the Importance of Olfactory and Immune Systems in Their Fast Radiation. Genome Biol Evol 2024;16(11):evae233
  164. Goverde CA, Pacesa M, Goldbach N, Dornfeld LJ, Balbi PEM, Georgeon S, Rosset S, Kapoor S, Choudhury J, Dauparas J, Schellhaas C, Kozlov S, Baker D, Ovchinnikov S, Vecchio AJ, Correia BE. Computational design of soluble and functional membrane protein analogues. Nature 2024;631(8020):449-458
  165. Grand RS, Pregnolato M, Baumgartner L, Hoerner L, Burger L, Schübeler D. Genome access is transcription factor-specific and defined by nucleosome position. Mol Cell 2024;84(18):3455-3468.e6
  166. Grobecker P, Sakoparnig T, van Nimwegen E. Identifying cell states in single-cell RNA-seq data at statistically maximal resolution. PLoS Comput Biol 2024;20(7):e1012224
  167. Grüterich L, Woodhouse JN, Mueller P, Tiemann A, Ruscheweyh H-J, Sunagawa S, Grossart H-P, Streit WR. Assessing environmental gradients in relation to dark CO<sub>2</sub> fixation in estuarine wetland microbiomes. Appl Environ Microbiol 2025;91(1):e0217724
  168. Gudipati RK, Gaidatzis D, Seebacher J, Muehlhaeusser S, Kempf G, Cavadini S, Hess D, Soneson C, Großhans H. Deep quantification of substrate turnover defines protease subsite cooperativity. Mol Syst Biol 2024;20(12):1303-1328
  169. Gunapala KM, Gadban A, Noreen F, Schär P, Benvenisty N, Taylor V. Ascorbic Acid Ameliorates Molecular and Developmental Defects in Human-Induced Pluripotent Stem Cell and Cerebral Organoid Models of Fragile X Syndrome. Int J Mol Sci 2024;25(23):12718
  170. Hale BD, Severin Y, Graebnitz F, Stark D, Guignard D, Mena J, Festl Y, Lee S, Hanimann J, Zangger NS, Meier M, Goslings D, Lamprecht O, Frey BM, Oxenius A, Snijder B. Cellular architecture shapes the naïve T cell response. Science 2024;384(6700):eadh8697
  171. Harteveld Z, Van Hall-Beauvais A, Morozova I, Southern J, Goverde C, Georgeon S, Rosset S, Defferrard M, Loukas A, Vandergheynst P, Bronstein MM, Correia BE. Exploring "dark-matter" protein folds using deep learning. Cell Syst 2024;15(10):898-910.e5
  172. Hassan A, Blakeley G, McGregor AP, Zancolli G. Venom gland organogenesis in the common house spider. Sci Rep 2024;14(1):15379
  173. Hassan A, Blakeley G, McGregor AP, Zancolli G. Venom gland organogenesis in the common house spider 2024
  174. Hastings J, Zhang L, Schenk P, West R, Gehrke B, Hogan WR, Chorpita B, Johnston M, Marques MM, Webb TL, Baird HM, Crombez G, Michie S. The BSSO Foundry: A community of practice for ontologies in the behavioural and social sciences. Wellcome Open Res 2024;9:656
  175. Hauffe T, Cantalapiedra JL, Silvestro D. Trait-mediated speciation and human-driven extinctions in proboscideans revealed by unsupervised Bayesian neural networks. Sci Adv2024;10(30):eadl2643
  176. Hedayat S, Cascione L, Cunningham D, Schirripa M, Lampis A, Hahne JC, Tunariu N, Hong SP, Marchetti S, Khan K, Fontana E, Angerilli V, Delrieux M, Nava Rodrigues D, Procaccio L, Rao S, Watkins D, Starling N, Chau I, Braconi C, Fotiadis N, Begum R, Guppy N, Howell L, Valenti M, Cribbes S, Kolozsvari B, Kirkin V, Lonardi S, Ghidini M, Passalacqua R, Elghadi R, Magnani L, Pinato DJ, Di Maggio F, Ghelardi F, Sottotetti E, Vetere G, Ciracì P, Vlachogiannis G, Pietrantonio F, Cremolini C, Cortellini A, Loupakis F, Fassan M, Valeri N. Circulating microRNA Analysis in a Prospective Co-clinical Trial Identifies MIR652-3p as a Response Biomarker and Driver of Regorafenib Resistance Mechanisms in Colorectal Cancer. Clin Cancer Res 2024;30(10):2140-2159
  177. Hillenbrand CA, Akbari Bani D, Follonier O, Kaur A, Weissbach FH, Wernli M, Wilhelm M, Leuzinger K, Binet I, Bochud PY, Golshayan D, Hirzel C, Manuel O, Mueller NJ, Schaub S, Schachtner T, Van Delden C, Hirsch HH, Swiss Transplant Cohort Study. BK polyomavirus serotype-specific antibody responses in blood donors and kidney transplant recipients with and without new-onset BK polyomavirus-DNAemia: A Swiss Transplant Cohort Study. Am J Transplant 2024:S1600-6135(24)00707-X
  178. Hinz A, Amado A, Kassen R, Bank C, Wong A. Unpredictability of the Fitness Effects of Antimicrobial Resistance Mutations Across Environments in Escherichia coli. Mol Biol Evol2024;41(5):msae086
  179. Hiza H, Zwyer M, Hella J, Arbués A, Sasamalo M, Borrell S, Xu ZM, Ross A, Brites D, Fellay J, Reither K, Gagneux S, Portevin D. Bacterial diversity dominates variable macrophage responses of tuberculosis patients in Tanzania. Sci Rep 2024;14(1):9287
  180. Hochart C, Rouzé H, Rivière B, Ruscheweyh HJ, Hédouin L, Pochon X, Steneck RS, Poulain J, Belser C, Nugues MM, Galand PE. High diversity of crustose coralline algae microbiomes across species and islands, and implications for coral recruits. Environ Microbiome 2024;19(1):112
  181. Hodel F, De Min MB, Thorball CW, Redin C, Vollenweider P, Girardin F, Fellay J. Prevalence of actionable pharmacogenetic variants and high-risk drug prescriptions: A Swiss hospital-based cohort study. Clin Transl Sci 2024;17(9):e70009
  182. Hornauer P, Prack G, Anastasi N, Ronchi S, Kim T, Donner C, Fiscella M, Borgwardt K, Taylor V, Jagasia R, Roqueiro D, Hierlemann A, Schröter M. DeePhys: A machine learning-assisted platform for electrophysiological phenotyping of human neuronal networks. Stem Cell Reports 2024;19(2):285-298
  183. Hruska-Plochan M, Wiersma VI, Betz KM, Mallona I, Ronchi S, Maniecka Z, Hock EM, Tantardini E, Laferriere F, Sahadevan S, Hoop V, Delvendahl I, Pérez-Berlanga M, Gatta B, Panatta M, van der Bourg A, Bohaciakova D, Sharma P, De Vos L, Frontzek K, Aguzzi A, Lashley T, Robinson MD, Karayannis T, Mueller M, Hierlemann A, Polymenidou M. A model of human neural networks reveals NPTX2 pathology in ALS and FTLD. Nature 2024;626(8001):1073-1083
  184. Huber F, Arnaud M, Stevenson BJ, Michaux J, Benedetti F, Thevenet J, Bobisse S, Chiffelle J, Gehert T, Müller M, Pak H, Krämer AI, Altimiras ER, Racle J, Taillandier-Coindard M, Muehlethaler K, Auger A, Saugy D, Murgues B, Benyagoub A, Gfeller D, Laniti DD, Kandalaft L, Rodrigo BN, Bouchaab H, Tissot S, Coukos G, Harari A, Bassani-Sternberg M. A comprehensive proteogenomic pipeline for neoantigen discovery to advance personalized cancer immunotherapy. Nat Biotechnol 2024
  185. Huber K, Giralt A, Dreos R, Michenthaler H, Geller S, Barquissau V, Ziegler DV, Tavernari D, Gallart-Ayala H, Krajina K, Jonas K, Ciriello G, Ivanisevic J, Prokesch A, Pichler M, Fajas L. E2F transcription factor-1 modulates expression of glutamine metabolic genes in mouse embryonic fibroblasts and uterine sarcoma cells. Biochim Biophys Acta Mol Cell Res 2024;1871(5):119721
  186. Hurcombe JA, Dayalan L, Barrington F, Burdet F, Ni L, Coward JT, Brinkkoetter PT, Holzenberger M, Jeffries A, Oltean S, Welsh GI, Coward RJ. The insulin / IGF axis is critically important controlling gene transcription in the podocyte 2024
  187. Hutchison WJ, Keyes TJ, tidyomics Consortium, Crowell HL, Serizay J, Soneson C, Davis ES, Sato N, Moses L, Tarlinton B, Nahid AA, Kosmac M, Clayssen Q, Yuan V, Mu W, Park JE, Mamede I, Ryu MH, Axisa PP, Paiz P, Poon CL, Tang M, Gottardo R, Morgan M, Lee S, Lawrence M, Hicks SC, Nolan GP, Davis KL, Papenfuss AT, Love MI, Mangiola S. The tidyomics ecosystem: enhancing omic data analyses. Nat Methods 2024;21(7):1166-1170
  188. Håkansson S, Tuci M, Bolliger M, Curt A, Jutzeler CR, Brüningk S. Data-driven prediction of spinal cord injury recovery: an exploration of current status and future perspectives 2024
  189. Håkansson S, Tuci M, Bolliger M, Curt A, Jutzeler CR, Brüningk SC. Data-driven prediction of spinal cord injury recovery: An exploration of current status and future perspectives. Exp Neurol2024;380:114913
  190. Hédelin L, Thiébaut A, Huang J, Li X, Lemoine A, Haas G, Meignin C, Cai H, Waterhouse RM, Martins N, Imler JL. Investigating the Evolution of Drosophila STING-Dependent Antiviral Innate Immunity by Multispecies Comparison of 2'3'-cGAMP Responses. Mol Biol Evol 2024;41(3):msae032
  191. Iglhaut C, Pečerska J, Gil M, Anisimova M. Please Mind the Gap: Indel-Aware Parsimony for Fast and Accurate Ancestral Sequence Reconstruction and Multiple Sequence Alignment Including Long Indels. Mol Biol Evol 2024;41(7):msae109
  192. Immer A, Stark SG, Jacob F, Bonilla X, Thomas T, Kahles A, Goetze S, Milani ES, Wollscheid B, Tumor Profiler Consortium, Rätsch G, Lehmann KV. Probabilistic pathway-based multimodal factor analysis. Bioinformatics 2024;40(suppl 1):i189-i198
  193. Iurlaro M, Masoni F, Flyamer IM, Wirbelauer C, Iskar M, Burger L, Giorgetti L, Schübeler D. Systematic assessment of ISWI subunits shows that NURF creates local accessibility for CTCF. Nat Genet 2024;56(6):1203-1212
  194. Iurlaro M, Masoni F, Flyamer IM, Wirbelauer C, Iskar M, Burger L, Giorgetti L, Schübeler D. Author Correction: Systematic assessment of ISWI subunits shows that NURF creates local accessibility for CTCF. Nat Genet 2024;56(11):2574-2575
  195. Iyer RS, Needham SR, Galdadas I, Davis BM, Roberts SK, Man RCH, Zanetti-Domingues LC, Clarke DT, Fruhwirth GO, Parker PJ, Rolfe DJ, Gervasio FL, Martin-Fernandez ML. Drug-resistant EGFR mutations promote lung cancer by stabilizing interfaces in ligand-free kinase-active EGFR oligomers. Nat Commun 2024;15(1):2130
  196. Jaeger-Ruckstuhl CA, Lo Y, Fulton E, Waltner OG, Shabaneh TB, Simon S, Muthuraman PV, Correnti CE, Newsom OJ, Engstrom IA, Kanaan SB, Bhise SS, Peralta JMC, Ruff R, Price JP, Stull SM, Stevens AR, Bugos G, Kluesner MG, Voillet V, Muhunthan V, Morrish F, Olson JM, Gottardo R, Sarthy JF, Henikoff S, Sullivan LB, Furlan SN, Riddell SR. Signaling via a CD27-TRAF2-SHP-1 axis during naive T cell activation promotes memory-associated gene regulatory networks. Immunity 2024;57(2):287-302.e12
  197. Jalan M, Sharma A, Pei X, Weinhold N, Buechelmaier ES, Zhu Y, Ahmed-Seghir S, Ratnakumar A, Di Bona M, McDermott N, Gomez-Aguilar J, Anderson KS, Ng CKY, Selenica P, Bakhoum SF, Reis-Filho JS, Riaz N, Powell SN. RAD52 resolves transcription-replication conflicts to mitigate R-loop induced genome instability. Nat Commun 2024;15(1):7776
  198. Jasinski SR, Presby DM, Grosicki GJ, Capodilupo ER, Lee VH. A Novel method for quantifying fluctuations in wearable derived daily cardiovascular parameters across the menstrual cycle. NPJ Digit Med 2024;7(1):373
  199. Jasper RJ, Yeaman S. Local adaptation can cause both peaks and troughs in nucleotide diversity within populations. G3 (Bethesda) 2024;14(11):jkae225
  200. Jauch AJ, Alborelli I, Reusser A, Baschong A, Rütsche C, Bignucolo O, Passweg J, Dirnhofer S, Krasniqi F. Case report: 'Atypical Richter transformation from CLL-type monoclonal B-cell lymphocytosis into Burkitt lymphoma in a treatment naïve patient'. Front Oncol 2024;14:1296238
  201. Javan SL, Kashkooli AB, Shojaeiyan A, Majidian S. Transcriptomic data reveals the dynamics of terpenoids biosynthetic pathway of fenugreek. BMC Genomics 2024;25(1):390
  202. Jin C, Venkatakrishnan V, Thomsson KA, Aoki NP, Shinmachi D, Aoki-Kinoshita KF, Hayes CA, Lisacek F, Karlsson NG. UniCarb-DB: An MS/MS Experimental Glycomic Fragmentation Database. Methods Mol Biol 2024;2836:77-96
  203. John A, Dreifuss D, Kang S, Bratus-Neuenschwander A, Zajac N, Topolsky I, Dondi A, Aquino C, Julian TR, Beerenwinkel N. Assessing different next-generation sequencing technologies for wastewater-based epidemiology. Water Res 2024;267:122465
  204. Joseph J, Prentout D, Laverré A, Tricou T, Duret L. High prevalence of PRDM9-independent recombination hotspots in placental mammals. Proc Natl Acad Sci U S A2024;121(23):e2401973121
  205. Jowkar G, Pečerska J, Gil M, Anisimova M. Single-character insertion-deletion model preserves long indels in ancestral sequence reconstruction. BMC Bioinformatics 2024;25(1):370
  206. Judge C, Vaughan T, Russell T, Abbott S, du Plessis L, Stadler T, Brady O, Hill S. EpiFusion: Joint inference of the effective reproduction number by integrating phylodynamic and epidemiological modelling with particle filtering. PLoS Comput Biol 2024;20(11):e1012528
  207. Julian TR, Devaux AJ, Brülisauer L, Conforti S, Rusch JC, Gan C, Bagutti C, Stadler T, Kohn T, Ort C. Monitoring an Emergent Pathogen at Low Incidence in Wastewater Using qPCR: Mpox in Switzerland. Food Environ Virol 2024;16(3):269-279
  208. Junyent S, Meglicki M, Vetter R, Mandelbaum R, King C, Patel EM, Iwamoto-Stohl L, Reynell C, Chen DY, Rubino P, Arrach N, Paulson RJ, Iber D, Zernicka-Goetz M. The first two blastomeres contribute unequally to the human embryo. Cell 2024;187(11):2838-2854.e17
  209. Jänes J, Beltrao P. Deep learning for protein structure prediction and design-progress and applications. Mol Syst Biol 2024;20(3):162-169
  210. Kalnapenkis A, Jõeloo M, Lepik K, Kukuškina V, Kals M, Alasoo K, Estonian Biobank Research Team, Mägi R, Esko T, Võsa U. Genetic determinants of plasma protein levels in the Estonian population. Sci Rep 2024;14(1):7694
  211. Kawamura YK, Ozonov EA, Papasaikas P, Kondo T, Nguyen NV, Stadler MB, Smallwood SA, Koseki H, Peters AH. Preventing CpG island hypermethylation in oocytes safeguards mouse development 2024
  212. Keaton JM, Kamali Z, Xie T, Vaez A, Williams A, Goleva SB, Ani A, Evangelou E, Hellwege JN, Yengo L, Young WJ, Traylor M, Giri A, Zheng Z, Zeng J, Chasman DI, Morris AP, Caulfield MJ, Hwang SJ, Kooner JS, Conen D, Attia JR, Morrison AC, Loos RJF, Kristiansson K, Schmidt R, Hicks AA, Pramstaller PP, Nelson CP, Samani NJ, Risch L, Gyllensten U, Melander O, Riese H, Wilson JF, Campbell H, Rich SS, Psaty BM, Lu Y, Rotter JI, Guo X, Rice KM, Vollenweider P, Sundström J, Langenberg C, Tobin MD, Giedraitis V, Luan J, Tuomilehto J, Kutalik Z, Ripatti S, Salomaa V, Girotto G, Trompet S, Jukema JW, van der Harst P, Ridker PM, Giulianini F, Vitart V, Goel A, Watkins H, Harris SE, Deary IJ, van der Most PJ, Oldehinkel AJ, Keavney BD, Hayward C, Campbell A, Boehnke M, Scott LJ, Boutin T, Mamasoula C, Järvelin MR, Peters A, Gieger C, Lakatta EG, Cucca F, Hui J, Knekt P, Enroth S, De Borst MH, Polašek O, Concas MP, Catamo E, Cocca M, Li-Gao R, Hofer E, Schmidt H, Spedicati B, Waldenberger M, Strachan DP, Laan M, Teumer A, Dörr M, Gudnason V, Cook JP, Ruggiero D, Kolcic I, Boerwinkle E, Traglia M, Lehtimäki T, Raitakari OT, Johnson AD, Newton-Cheh C, Brown MJ, Dominiczak AF, Sever PJ, Poulter N, Chambers JC, Elosua R, Siscovick D, Esko T, Metspalu A, Strawbridge RJ, Laakso M, Hamsten A, Hottenga JJ, de Geus E, Morris AD, Palmer CNA, Nolte IM, Milaneschi Y, Marten J, Wright A, Zeggini E, Howson JMM, O'Donnell CJ, Spector T, Nalls MA, Simonsick EM, Liu Y, van Duijn CM, Butterworth AS, Danesh JN, Menni C, Wareham NJ, Khaw KT, Sun YV, Wilson PWF, Cho K, Visscher PM, Denny JC, Million Veteran Program, Lifelines Cohort Study, CHARGE consortium, ICBP Consortium, Levy D, Edwards TL, Munroe PB, Snieder H, Warren HR. Genome-wide analysis in over 1 million individuals of European ancestry yields improved polygenic risk scores for blood pressure traits. Nat Genet 2024;56(5):778-791
  213. Keller F, Denicolò S, Leierer J, Kruus M, Heinzel A, Kammer M, Ju W, Nair V, Burdet F, Ibberson M, Menon R, Otto E, Choi YJ, Pyle L, Ladd P, Bjornstad PM, Eder S, Rosivall L, Mark PB, Wiecek A, Heerspink HJL, Kretzler M, Oberbauer R, Mayer G, Perco P. Association of Urinary Epidermal Growth Factor, Fatty Acid-Binding Protein 3, and Vascular Cell Adhesion Molecule 1 Levels with the Progression of Early Diabetic Kidney Disease. Kidney Blood Press Res 2024;49(1):1013-1025
  214. Khameneh HJ, Bolis M, Ventura PMO, Cassanmagnago GA, Fischer BA, Zenobi A, Guerra J, Buzzago I, Bernasconi M, Zaman GJR, Rinaldi A, Moro SG, Sallusto F, Baulier E, Pasquali C, Guarda G. The bacterial lysate OM-85 engages Toll-like receptors 2 and 4 triggering an immunomodulatory gene signature in human myeloid cells. Mucosal Immunol 2024;17(3):346-358
  215. Kienbeck K, Malfertheiner L, Zelger-Paulus S, Johannsen S, von Mering C, Sigel RKO. Identification of HDV-like theta ribozymes involved in tRNA-based recoding of gut bacteriophages. Nat Commun 2024;15(1):1559
  216. Klein P, Petrić Howe M, Harley J, Crook H, Esteban Serna S, Roumeliotis TI, Choudhary JS, Chakrabarti AM, Luisier R, Patani R, Ramos A. m6a methylation orchestrates IMP1 regulation of microtubules during human neuronal differentiation. Nat Commun 2024;15(1):4819
  217. Kraemer D, Terumalai D, Famiglietti M, Filges I, Joset P, Koller S, Maurer F, Meier S, Nouspikel T, Sanz J, Zweier C, Abramowicz M, Berger W, Cichon S, Schaller A, Superti-Furga A, Barbié V, Rauch A. SwissGenVar: A Platform for Clinical-Grade Interpretation of Genetic Variants to Foster Personalized Healthcare in Switzerland J Pers Med 2024;14(6)
  218. Kraemer D, Terumalai D, Famiglietti ML, Filges I, Joset P, Koller S, Maurer F, Meier S, Nouspikel T, Sanz J, Zweier C, Abramowicz M, Berger W, Cichon S, Schaller A, Superti-Furga A, Barbié V, Rauch A. SwissGenVar: A Platform for Clinical-Grade Interpretation of Genetic Variants to Foster Personalized Healthcare in Switzerland. J Pers Med 2024;14(6):648
  219. Krapp LF, Meireles FA, Abriata LA, Devillard J, Vacle S, Marcaida MJ, Dal Peraro M. Context-aware geometric deep learning for protein sequence design. Nat Commun 2024;15(1):6273
  220. Kribelbauer-Swietek JF, Pushkarev O, Gardeux V, Faltejskova K, Russeil J, van Mierlo G, Deplancke B. Context transcription factors establish cooperative environments and mediate enhancer communication. Nat Genet 2024;56(10):2199-2212
  221. Krupnik L, Avaro J, Liebi M, Anaraki NI, Kohlbrecher J, Sologubenko A, Handschin S, Rzepiela AJ, Appel C, Totu T, Blanchet CE, Alston AEB, Digigow R, Philipp E, Flühmann B, Silva BFB, Neels A, Wick P. Iron-carbohydrate complexes treating iron anaemia: Understanding the nano-structure and interactions with proteins through orthogonal characterisation. J Control Release2024;368:566-579
  222. Kruta J, Carapito R, Trendelenburg M, Martin T, Rizzi M, Voll RE, Cavalli A, Natali E, Meier P, Stawiski M, Mosbacher J, Mollet A, Santoro A, Capri M, Giampieri E, Schkommodau E, Miho E.Machine learning for precision diagnostics of autoimmunity. Sci Rep 2024;14(1):27848
  223. Kuhl H, Euclide PT, Klopp C, Cabau C, Zahm M, Lopez-Roques C, Iampietro C, Kuchly C, Donnadieu C, Feron R, Parrinello H, Poncet C, Jaffrelo L, Confolent C, Wen M, Herpin A, Jouanno E, Bestin A, Haffray P, Morvezen R, de Almeida TR, Lecocq T, Schaerlinger B, Chardard D, Żarski D, Larson WA, Postlethwait JH, Timirkhanov S, Kloas W, Wuertz S, Stöck M, Guiguen Y. Multi-genome comparisons reveal gain-and-loss evolution of anti-Mullerian hormone receptor type 2 as a candidate master sex-determining gene in Percidae. BMC Biol 2024;22(1):141
  224. Kuhl H, Tan WH, Klopp C, Kleiner W, Koyun B, Ciorpac M, Feron R, Knytl M, Kloas W, Schartl M, Winkler C, Stöck M. A candidate sex determination locus in amphibians which evolved by structural variation between X- and Y-chromosomes. Nat Commun 2024;15(1):4781
  225. Kumar M, Michael S, Alvarado-Valverde J, Zeke A, Lazar T, Glavina J, Nagy-Kanta E, Donagh JM, Kalman ZE, Pascarelli S, Palopoli N, Dobson L, Suarez CF, Van Roey K, Krystkowiak I, Griffin JE, Nagpal A, Bhardwaj R, Diella F, Mészáros B, Dean K, Davey NE, Pancsa R, Chemes LB, Gibson TJ. ELM-the Eukaryotic Linear Motif resource-2024 update. Nucleic Acids Res2024;52(d1):D442-D455
  226. Kyriakakis E, Medde C, Ritz D, Fucile G, Schmidt A, Spang A. Bacterial RNA promotes proteostasis through inter-tissue communication inC. elegans 2024
  227. Lai PT, Coudert E, Aimo L, Axelsen K, Breuza L, de Castro E, Feuermann M, Morgat A, Pourcel L, Pedruzzi I, Poux S, Redaschi N, Rivoire C, Sveshnikova A, Wei CH, Leaman R, Luo L, Lu Z, Bridge A. EnzChemRED, a rich enzyme chemistry relation extraction dataset. Sci Data 2024;11(1):982
  228. Lai TF, Jankov D, Grossmann J, Roschitzki B, Huwiler SG. Quantitative proteome of bacterial periplasmic predation reveals a prey damaging protease 2024
  229. Langschied F, Bordin N, Cosentino S, Fuentes-Palacios D, Glover N, Hiller M, Hu Y, Huerta-Cepas J, Coelho LP, Iwasaki W, Majidian S, Manzano-Morales S, Persson E, Richards TA, Gabaldón T, Sonnhammer E, Thomas PD, Dessimoz C, Ebersberger I. Quest for Orthologs in the Era of Biodiversity Genomics. Genome Biol Evol 2024;16(10):evae224
  230. Larivière D, Abueg L, Brajuka N, Gallardo-Alba C, Grüning B, Ko BJ, Ostrovsky A, Palmada-Flores M, Pickett BD, Rabbani K, Antunes A, Balacco JR, Chaisson MJP, Cheng H, Collins J, Couture M, Denisova A, Fedrigo O, Gallo GR, Giani AM, Gooder GM, Horan K, Jain N, Johnson C, Kim H, Lee C, Marques-Bonet T, O'Toole B, Rhie A, Secomandi S, Sozzoni M, Tilley T, Uliano-Silva M, van den Beek M, Williams RW, Waterhouse RM, Phillippy AM, Jarvis ED, Schatz MC, Nekrutenko A, Formenti G. Scalable, accessible and reproducible reference genome assembly and evaluation in Galaxy. Nat Biotechnol 2024;42(3):367-370
  231. Larrue C, Mouche S, Angelino P, Sajot M, Birsen R, Kosmider O, Mckee T, Vergez F, Recher C, Mas VM, Gu Q, Xu J, Tsantoulis P, Sarry JE, Tamburini J. Targeting ferritinophagy impairs quiescent cancer stem cells in acute myeloid leukemia in vitro and in vivo models. Sci Transl Med 2024;16(757):eadk1731
  232. Lavanchy E, Cumer T, Topaloudis A, Ducrest AL, Simon C, Roulin A, Goudet J. Too big to purge: persistence of deleterious Mutations in Island populations of the European Barn Owl (Tyto alba). Heredity (Edinb) 2024;133(6):437-449
  233. Lavanchy E, Weir BS, Goudet J. Detecting inbreeding depression in structured populations. Proc Natl Acad Sci U S A 2024;121(19):e2315780121
  234. Lay AC, Tran VDT, Nair V, Betin V, Hurcombe JA, Barrington AF, Pope RJ, Burdet F, Mehl F, Kryvokhyzha D, Ahmad A, Sinton MC, Lewis P, Wilson MC, Menon R, Otto E, Heesom KJ, Ibberson M, Looker HC, Nelson RG, Ju W, Kretzler M, Satchell SC, Gomez MF, Coward RJM, BEAt-DKD consortium. Profiling of insulin-resistant kidney models and human biopsies reveals common and cell-type-specific mechanisms underpinning Diabetic Kidney Disease. Nat Commun 2024;15(1):10018
  235. Leclerc E, Pachkov M, Morisseau L, Tokito F, Legallais C, Jellali R, Nishikawa M, Abderrahmani A, Sakai Y. Investigation of the motif activity of transcription regulators in pancreatic β-like cell subpopulations differentiated from human induced pluripotent stem cells. Mol Omics 2024;20(10):654-665
  236. Lee S, Weiss T, Bühler M, Mena J, Lottenbach Z, Wegmann R, Sun M, Bihl M, Augustynek B, Baumann SP, Goetze S, van Drogen A, Pedrioli PGA, Penton D, Festl Y, Buck A, Kirschenbaum D, Zeitlberger AM, Neidert MC, Vasella F, Rushing EJ, Wollscheid B, Hediger MA, Weller M, Snijder B. High-throughput identification of repurposable neuroactive drugs with potent anti-glioblastoma activity. Nat Med 2024;30(11):3196-3208
  237. Leo S, Crusoe MR, Rodríguez-Navas L, Sirvent R, Kanitz A, De Geest P, Wittner R, Pireddu L, Garijo D, Fernández JM, Colonnelli I, Gallo M, Ohta T, Suetake H, Capella-Gutierrez S, de Wit R, Kinoshita BP, Soiland-Reyes S. Recording provenance of workflow runs with RO-Crate. PLoS One 2024;19(9):e0309210
  238. Leutheuser H, Bartholet M, Marx A, Pfister M, Burckhardt M, Bachmann S, Vogt J. Predicting risk for nocturnal hypoglycemia after physical activity in children with type 1 diabetes Front Med (Lausanne) 2024;11
  239. Leutheuser H, Bartholet M, Marx A, Pfister M, Burckhardt MA, Bachmann S, Vogt JE. Predicting risk for nocturnal hypoglycemia after physical activity in children with type 1 diabetes. Front Med (Lausanne) 2024;11:1439218
  240. Li Q, Ruscheweyh HJ, Østergaard LH, Libertella M, Simonsen KS, Sunagawa S, Scoma A, Schwab C. Trait-based study predicts glycerol/diol dehydratases as a key function of the gut microbiota of hindgut-fermenting carnivores. Microbiome 2024;12(1):178
  241. Li S, Dragan I, Tran VDT, Fung CH, Kuznetsov D, Hansen MK, Beulens JWJ, Hart LM', Slieker RC, Donnelly LA, Gerl MJ, Klose C, Mehl F, Simons K, Elders PJM, Pearson ER, Rutter GA, Ibberson M. Multi-omics subgroups associated with glycaemic deterioration in type 2 diabetes: an IMI-RHAPSODY Study. Front Endocrinol (Lausanne) 2024;15:1350796
  242. Li X, Visser S, Son JH, Geuverink E, Kıvanç EN, Wu Y, Schmeing S, Pippel M, Anvar SY, Schenkel MA, Marec F, Robinson MD, Meisel RP, Wimmer EA, van de Zande L, Bopp D, Beukeboom LW.Divergent evolution of male-determining loci on proto-Y chromosomes of the housefly. Nat Commun 2024;15(1):5984
  243. Li Y, Thomas GWC, Richards S, Waterhouse RM, Zhou X, Pfrender ME. Rapid evolution of mitochondrion-related genes in haplodiploid arthropods. BMC Biol 2024;22(1):229
  244. Lison A, Abbott S, Huisman J, Stadler T. Generative Bayesian modeling to nowcast the effective reproduction number from line list data with missing symptom onset dates. PLoS Comput Biol 2024;20(4):e1012021
  245. Liu X, Song H, Chu D, Dai X, Wang F, Silvestro D. Heterogeneous selectivity and morphological evolution of marine clades during the Permian-Triassic mass extinction. Nat Ecol Evol2024;8(7):1248-1258
  246. Lizano AMD, Kim KM, Juinio-Meñez MA, Ravago-Gotanco R. Pseudocryptic diversity and species boundaries in the sea cucumber Stichopus cf. horrens (Echinodermata: Stichopodidae) revealed by mitochondrial and microsatellite markers. Sci Rep 2024;14(1):4886
  247. Louviot F, Abdelrahman O, Abou-Mansour E, L'Haridon F, Allard P-M, Falquet L, Weisskopf L. Oligomycin-producing Streptomyces sp. newly isolated from Swiss soils efficiently protect Arabidopsis thaliana against Botrytis cinerea. mSphere 2024;9(7):e0066723
  248. Luo S, Germain PL, Robinson MD, von Meyenn F. Benchmarking computational methods for single-cell chromatin data analysis. Genome Biol 2024;25(1):225
  249. Lupo U, Sgarbossa D, Bitbol AF. Pairing interacting protein sequences using masked language modeling. Proc Natl Acad Sci U S A 2024;121(27):e2311887121
  250. Lupo U, Sgarbossa D, Milighetti M, Bitbol AF. DiffPaSS-high-performance differentiable pairing of protein sequences using soft scores. Bioinformatics 2024;41(1):btae738
  251. Lykoskoufis NMR, Planet E, Ongen H, Trono D, Dermitzakis ET. Transposable elements mediate genetic effects altering the expression of nearby genes in colorectal cancer. Nat Commun2024;15(1):749
  252. López-Cobo S, Fuentealba JR, Gueguen P, Bonté PE, Tsalkitzi K, Chacón I, Glauzy S, Bohineust A, Biquand A, Silva L, Gouveia Z, Goudot C, Perez F, Saitakis M, Amigorena S. SUV39H1 Ablation Enhances Long-term CAR T Function in Solid Tumors. Cancer Discov 2024;14(1):120-141
  253. Lüchtefeld I, Pivkin IV, Gardini L, Zare-Eelanjegh E, Gäbelein C, Ihle SJ, Reichmuth AM, Capitanio M, Martinac B, Zambelli T, Vassalli M. Dissecting cell membrane tension dynamics and its effect on Piezo1-mediated cellular mechanosensitivity using force-controlled nanopipettes. Nat Methods 2024;21(6):1063-1073
  254. Macnair W, Calini D, Agirre E, Bryois J, Jäkel S, Smith RS, Kukanja P, Stokar-Regenscheit N, Ott V, Foo LC, Collin L, Schippling S, Urich E, Nutma E, Marzin M, Ansaloni F, Amor S, Magliozzi R, Heidari E, Robinson MD, Ffrench-Constant C, Castelo-Branco G, Williams A, Malhotra D. snRNA-seq stratifies multiple sclerosis patients into distinct white matter glial responses. Neuron2025;113(3):396-410.e9
  255. Majander K, Pla-Díaz M, du Plessis L, Arora N, Filippini J, Pezo-Lanfranco L, Eggers S, González-Candelas F, Schuenemann VJ. Redefining the treponemal history through pre-Columbian genomes from Brazil. Nature 2024;627(8002):182-188
  256. Mangilet AF, Weber J, Schüler S, Adler M, Mjema EY, Heilmann P, Herold A, Renneberg M, Nagel L, Droste-Borel I, Streicher S, Schmutzer T, Rot G, Macek B, Schmidtke C, Laubinger S. The Arabidopsis U1 snRNP regulates mRNA 3'-end processing. Nat Plants 2024;10(10):1514-1531
  257. Marchal A, Cirulli ET, Neveux I, Bellos E, Thwaites RS, Schiabor Barrett KM, Zhang Y, Nemes-Bokun I, Kalinova M, Catchpole A, Tangye SG, Spaan AN, Lack JB, Ghosn J, Burdet C, Gorochov G, Tubach F, Hausfater P, COVID Human Genetic Effort, COVIDeF Study Group, French COVID Cohort Study Group, CoV-Contact Cohort, COVID-STORM Clinicians, COVID Clinicians, Orchestra Working Group, Amsterdam UMC COVID-19 Biobank, NIAID-USUHS COVID Study Group, Dalgard CL, Zhang SY, Zhang Q, Chiu C, Fellay J, Grzymski JJ, Sancho-Shimizu V, Abel L, Casanova JL, Cobat A, Bolze A. Lack of association between classical HLA genes and asymptomatic SARS-CoV-2 infection. HGG Adv 2024;5(3):100300
  258. Marconato L, Palla G, Yamauchi KA, Virshup I, Heidari E, Treis T, Vierdag WM, Toth M, Stockhaus S, Shrestha RB, Rombaut B, Pollaris L, Lehner L, Vöhringer H, Kats I, Saeys Y, Saka SK, Huber W, Gerstung M, Moore J, Theis FJ, Stegle O. SpatialData: an open and universal data framework for spatial omics. Nat Methods 2025;22(1):58-62
  259. Marti A, Nater A, Pego Magalhaes J, Almeida L, Lewandowska M, Liniger M, Ruggli N, Grau-Roma L, Brito F, Alnaji FG, Vignuzzi M, García-Nicolás O, Summerfield A. Fitness adaptations of Japanese encephalitis virus in pigs following vector-free serial passaging. PLoS Pathog 2024;20(8):e1012059
  260. Martinez K, Agirre J, Akune Y, Aoki-Kinoshita KF, Arighi C, Axelsen KB, Bolton E, Bordeleau E, Edwards NJ, Fadda E, Feizi T, Hayes C, Ives CM, Joshi HJ, Krishna Prasad K, Kossida S, Lisacek F, Liu Y, Lütteke T, Ma J, Malik A, Martin M, Mehta AY, Neelamegham S, Panneerselvam K, Ranzinger R, Ricard-Blum S, Sanou G, Shanker V, Thomas PD, Tiemeyer M, Urban J, Vita R, Vora J, Yamamoto Y, Mazumder R. Functional implications of glycans and their curation: insights from the workshop held at the 16th Annual International Biocuration Conference in Padua, Italy.Database (Oxford) 2024;2024:baae073
  261. Martinez-Usatorre A, Ciarloni L, Angelino P, Wosika V, Conforte AJ, Fonseca Costa SS, Durandau E, Monnier-Benoit S, Satizabal HF, Despraz J, Perez-Uribe A, Delorenzi M, Morgenthaler S, Hashemi B, Hadadi N, Hosseinian-Ehrensberger S, Romero PJ. Human blood cell transcriptomics unveils dynamic systemic immune modulation along colorectal cancer progression. J Immunother Cancer 2024;12(11):e009888
  262. Matthias J, Lukas LP, Brüningk SC, Maier D, Mach O, Grassner L, Kramer JLK, Bourguignon L, Jutzeler CR. Exploring the potential of routine serological markers in predicting neurological outcomes in spinal cord injury. Exp Neurol 2024;380:114918
  263. Matuozzo D, Talouarn E, Marchal A, Zhang P, Manry J, Seeleuthner Y, Zhang Y, Bolze A, Chaldebas M, Milisavljevic B, Gervais A, Bastard P, Asano T, Bizien L, Barzaghi F, Abolhassani H, Tayoun AA, Aiuti A, Darazam IA, Allende LM, Alonso-Arias R, Arias AA, Aytekin G, Bergman P, Bondesan S, Bryceson YT, Bustos IG, Cabrera-Marante O, Carcel S, Carrera P, Casari G, Chaïbi K, Colobran R, Condino-Neto A, Covill LE, Delmonte OM, Zein LE, Flores C, Gregersen PK, Gut M, Haerynck F, Halwani R, Hancerli S, Hammarström L, Hatipoğlu N, Karbuz A, Keles S, Kyheng C, Leon-Lopez R, Franco JL, Mansouri D, Martinez-Picado J, Akcan OM, Migeotte I, Morange PE, Morelle G, Martin-Nalda A, Novelli G, Novelli A, Ozcelik T, Palabiyik F, Pan-Hammarström Q, de Diego RP, Planas-Serra L, Pleguezuelo DE, Prando C, Pujol A, Reyes LF, Rivière JG, Rodriguez-Gallego C, Rojas J, Rovere-Querini P, Schlüter A, Shahrooei M, Sobh A, Soler-Palacin P, Tandjaoui-Lambiotte Y, Tipu I, Tresoldi C, Troya J, van de Beek D, Zatz M, Zawadzki P, Al-Muhsen SZ, Alosaimi MF, Alsohime FM, Baris-Feldman H, Butte MJ, Constantinescu SN, Cooper MA, Dalgard CL, Fellay J, Heath JR, Lau YL, Lifton RP, Maniatis T, Mogensen TH, von Bernuth H, Lermine A, Vidaud M, Boland A, Deleuze JF, Nussbaum R, Kahn-Kirby A, Mentre F, Tubiana S, Gorochov G, Tubach F, Hausfater P, COVID Human Genetic Effort, COVIDeF Study Group, French COVID Cohort Study Group, CoV-Contact Cohort, COVID Clinicians, Orchestra Working Group, Amsterdam UMC Covid-19 Biobank, NIAID-USUHS COVID Study Group, Meyts I, Zhang SY, Puel A, Notarangelo LD, Boisson-Dupuis S, Su HC, Boisson B, Jouanguy E, Casanova JL, Zhang Q, Abel L, Cobat A. Correction: Rare predicted loss-of-function variants of type I IFN immunity genes are associated with life-threatening COVID-19. Genome Med 2024;16(1):6
  264. Mazzeo L, Ghosh S, Di Cicco E, Isma J, Tavernari D, Samarkina A, Ostano P, Youssef MK, Simon C, Dotto GP. ANKRD1 is a mesenchymal-specific driver of cancer-associated fibroblast activation bridging androgen receptor loss to AP-1 activation. Nat Commun 2024;15(1):1038
  265. Mc Cartney AM, Formenti G, Mouton A, De Panis D, Marins LS, Leitão HG, Diedericks G, Kirangwa J, Morselli M, Salces-Ortiz J, Escudero N, Iannucci A, Natali C, Svardal H, Fernández R, De Pooter T, Joris G, Strazisar M, Wood JMD, Herron KE, Seehausen O, Watts PC, Shaw F, Davey RP, Minotto A, Fernández JM, Böhne A, Alegria C, Alioto T, Alves PC, Amorim IR, Aury JM, Backstrom N, Baldrian P, Baltrunaite L, Barta E, BedHom B, Belser C, Bergsten J, Bertrand L, Bilandija H, Binzer-Panchal M, Bista I, Blaxter M, Borges PAV, Dias GB, Bosse M, Brown T, Bruggmann R, Buena-Atienza E, Burgin J, Buzan E, Cariani A, Casadei N, Chiara M, Chozas S, Čiampor F, Crottini A, Cruaud C, Cruz F, Dalen L, De Biase A, Del Campo J, Delic T, Dennis AB, Derks MFL, Diroma MA, Djan M, Duprat S, Eleftheriadi K, Feulner PGD, Flot JF, Forni G, Fosso B, Fournier P, Fournier-Chambrillon C, Gabaldon T, Garg S, Gissi C, Giupponi L, Gomez-Garrido J, González J, Grilo ML, Grüning B, Guerin T, Guiglielmoni N, Gut M, Haesler MP, Hahn C, Halpern B, Harrison PW, Heintz J, Hindrikson M, Höglund J, Howe K, Hughes GM, Istace B, Cock MJ, Janžekovič F, Jonsson ZO, Joye-Dind S, Koskimäki JJ, Krystufek B, Kubacka J, Kuhl H, Kusza S, Labadie K, Lähteenaro M, Lantz H, Lavrinienko A, Leclère L, Lopes RJ, Madsen O, Magdelenat G, Magoga G, Manousaki T, Mappes T, Marques JP, Redondo GIM, Maumus F, McCarthy SA, Megens HJ, Melo-Ferreira J, Mendes SL, Montagna M, Moreno J, Mosbech MB, Moura M, Musilova Z, Myers E, Nash WJ, Nater A, Nicholson P, Niell M, Nijland R, Noel B, Noren K, Oliveira PH, Olsen RA, Ometto L, Oomen RA, Ossowski S, Palinauskas V, Palsson S, Panibe JP, Pauperio J, Pavlek M, Payen E, Pawlowska J, Pellicer J, Pesole G, Pimenta J, Pippel M, Pirttilä AM, Poulakakis N, Rajan J, M C Rego R, Resendes R, Resl P, Riesgo A, Rodin-Morch P, Soares AER, Fernandes CR, Romeiras MM, Roxo G, Rüber L, Ruiz-Lopez MJ, Saarma U, da Silva LP, Sim-Sim M, Soler L, Sousa VC, Santos CS, Spada A, Stefanovic M, Steger V, Stiller J, Stöck M, Struck TH, Sudasinghe H, Tapanainen R, Tellgren-Roth C, Trindade H, Tukalenko Y, Urso I, Vacherie B, Van Belleghem SM, Van Oers K, Vargas-Chavez C, Velickovic N, Vella N, Vella A, Vernesi C, Vicente S, Villa S, Pettersson OV, Volckaert FAM, Voros J, Wincker P, Winkler S, Ciofi C, Waterhouse RM, Mazzoni CJ. The European Reference Genome Atlas: piloting a decentralised approach to equitable biodiversity genomics. NPJ Biodivers 2024;3(1):28
  266. Mc Cartney AM, Formenti G, Mouton A, De Panis D, Marins LS, Leitão HG, Diedericks G, Kirangwa J, Morselli M, Salces-Ortiz J, Escudero N, Iannucci A, Natali C, Svardal H, Fernández R, De Pooter T, Joris G, Strazisar M, Wood JMD, Herron KE, Seehausen O, Watts PC, Shaw F, Davey RP, Minotto A, Fernández JM, Böhne A, Alegria C, Alioto T, Alves PC, Amorim IR, Aury JM, Backstrom N, Baldrian P, Baltrunaite L, Barta E, BedHom B, Belser C, Bergsten J, Bertrand L, Bilandija H, Binzer-Panchal M, Bista I, Blaxter M, Borges PAV, Dias GB, Bosse M, Brown T, Bruggmann R, Buena-Atienza E, Burgin J, Buzan E, Cariani A, Casadei N, Chiara M, Chozas S, Čiampor F, Crottini A, Cruaud C, Cruz F, Dalen L, De Biase A, Del Campo J, Delic T, Dennis AB, Derks MFL, Diroma MA, Djan M, Duprat S, Eleftheriadi K, Feulner PGD, Flot JF, Forni G, Fosso B, Fournier P, Fournier-Chambrillon C, Gabaldon T, Garg S, Gissi C, Giupponi L, Gomez-Garrido J, González J, Grilo ML, Grüning B, Guerin T, Guiglielmoni N, Gut M, Haesler MP, Hahn C, Halpern B, Harrison PW, Heintz J, Hindrikson M, Höglund J, Howe K, Hughes GM, Istace B, Cock MJ, Janžekovič F, Jonsson ZO, Joye-Dind S, Koskimäki JJ, Krystufek B, Kubacka J, Kuhl H, Kusza S, Labadie K, Lähteenaro M, Lantz H, Lavrinienko A, Leclère L, Lopes RJ, Madsen O, Magdelenat G, Magoga G, Manousaki T, Mappes T, Marques JP, Redondo GIM, Maumus F, McCarthy SA, Megens HJ, Melo-Ferreira J, Mendes SL, Montagna M, Moreno J, Mosbech MB, Moura M, Musilova Z, Myers E, Nash WJ, Nater A, Nicholson P, Niell M, Nijland R, Noel B, Noren K, Oliveira PH, Olsen RA, Ometto L, Oomen RA, Ossowski S, Palinauskas V, Palsson S, Panibe JP, Pauperio J, Pavlek M, Payen E, Pawlowska J, Pellicer J, Pesole G, Pimenta J, Pippel M, Pirttilä AM, Poulakakis N, Rajan J, M C Rego R, Resendes R, Resl P, Riesgo A, Rodin-Morch P, Soares AER, Fernandes CR, Romeiras MM, Roxo G, Rüber L, Ruiz-Lopez MJ, Saarma U, da Silva LP, Sim-Sim M, Soler L, Sousa VC, Santos CS, Spada A, Stefanovic M, Steger V, Stiller J, Stöck M, Struck TH, Sudasinghe H, Tapanainen R, Tellgren-Roth C, Trindade H, Tukalenko Y, Urso I, Vacherie B, Van Belleghem SM, Van Oers K, Vargas-Chavez C, Velickovic N, Vella N, Vella A, Vernesi C, Vicente S, Villa S, Pettersson OV, Volckaert FAM, Voros J, Wincker P, Winkler S, Ciofi C, Waterhouse RM, Mazzoni CJ. Author Correction: The European Reference Genome Atlas: piloting a decentralised approach to equitable biodiversity genomics. NPJ Biodivers 2024;3(1):31
  267. McBroome J, de Bernardi Schneider A, Roemer C, Wolfinger MT, Hinrichs AS, O'Toole AN, Ruis C, Turakhia Y, Rambaut A, Corbett-Detig R. A framework for automated scalable designation of viral pathogen lineages from genomic data. Nat Microbiol 2024;9(2):550-560
  268. McDonald AG, Lisacek F. Simulated digestions of free oligosaccharides and mucin-type O-glycans reveal a potential role for Clostridium perfringens. Sci Rep 2024;14(1):1649
  269. Mellor J, Kuznetsov D, Heller S, Gall MA, Rosilio M, Amiel SA, Ibberson M, McGurnaghan S, Blackbourn L, Berthon W, Salem A, Qu Y, McCrimmon RJ, de Galan BE, Pedersen-Bjergaard U, Leaviss J, McKeigue PM, Colhoun HM. Risk factors and prediction of hypoglycaemia using the Hypo-RESOLVE cohort: a secondary analysis of pooled data from insulin clinical trials.Diabetologia 2024;67(8):1588-1601
  270. Mellor J, Kuznetsov D, Heller S, Gall MA, Rosilio M, Amiel SA, Ibberson M, McGurnaghan S, Blackbourn L, Berthon W, Salem A, Qu Y, McCrimmon RJ, de Galan BE, Pedersen-Bjergaard U, Leaviss J, McKeigue PM, Colhoun HM. Estimating risk of consequences following hypoglycaemia exposure using the Hypo-RESOLVE cohort: a secondary analysis of pooled data from insulin clinical trials. Diabetologia 2024;67(10):2210-2224
  271. Metzcar J, Jutzeler CR, Macklin P, Köhn-Luque A, Brüningk SC. A review of mechanistic learning in mathematical oncology. Front Immunol 2024;15:1363144
  272. Meyniel-Schicklin L, Amaudrut J, Mallinjoud P, Guillier F, Mangeot PE, Lines L, Aublin-Gex A, Scholtes C, Punginelli C, Joly S, Vasseur F, Manet E, Gruffat H, Henry T, Halitim F, Paparin JL, Machin P, Darteil R, Sampson D, Mikaelian I, Lane L, Navratil V, Golinelli-Cohen MP, Terzi F, André P, Lotteau V, Vonderscher J, Meldrum EC, de Chassey B. Viruses traverse the human proteome through peptide interfaces that can be biomimetically leveraged for drug discovery. Proc Natl Acad Sci U S A 2024;121(5):e2308776121
  273. Milighetti M, Nagano Y, Henderson J, Hershberg U, Tiffeau-Mayer A, Bitbol A, Chain B. Intra- and inter-chain contacts determine TCR specificity: applying protein co-evolution methods to TCRαβ pairing 2024
  274. Miravet-Verde S, Mazzolini R, Segura-Morales C, Broto A, Lluch-Senar M, Serrano L. ProTInSeq: transposon insertion tracking by ultra-deep DNA sequencing to identify translated large and small ORFs. Nat Commun 2024;15(1):2091
  275. Miravet-Verde S, Mazzolini R, Segura-Morales C, Broto A, Lluch-Senar M, Serrano L. Author Correction: ProTInSeq: transposon insertion tracking by ultra-deep DNA sequencing to identify translated large and small ORFs. Nat Commun 2024;15(1):2680
  276. Mittal N, Ataman M, Tintignac L, Ham DJ, Jörin L, Schmidt A, Sinnreich M, Ruegg MA, Zavolan M. Calorie restriction and rapamycin distinctly restore non-canonical ORF translation in the muscles of aging mice. NPJ Regen Med 2024;9(1):23
  277. Mlakar V, Dupanloup I, Gloor Y, Ansari M. Haplotype Inference Using Long-Read Nanopore Sequencing: Application to GSTA1 Promoter. Mol Biotechnol 2024
  278. Mlakar V, Dupanloup I, Gonzales F, Papangelopoulou D, Ansari M, Gumy-Pause F. 17q Gain in Neuroblastoma: A Review of Clinical and Biological Implications. Cancers (Basel) 2024;16(2):338
  279. Mlakar V, Lesne L, Vossio S, Dupanloup I, Gloor Y, Moreau D, Ansari M. Microcavity-assisted cloning (MAC) of hard-to-clone HepG2 cell lines: cloning made easy. BMC Biotechnol2024;24(1):81
  280. Moawad A, Abbara A, Bitbol AF. Evolution of cooperation in deme-structured populations on graphs. Phys Rev E 2024;109(2-1):024307
  281. Moi D, Dessimoz C. Frequent jumps from human hosts. Nat Ecol Evol 2024;8(5):854-855
  282. Moix S, Sadler M, Kutalik Z, Auwerx C. Breaking down causes, consequences, and mediating effects of age-related telomere shortening on human health 2024
  283. Moix S, Sadler MC, Kutalik Z, Auwerx C. Breaking down causes, consequences, and mediating effects of telomere length variation on human health. Genome Biol 2024;25(1):125
  284. Molton O, Bignucolo O, Kellenberger S. Identification of the modulatory Ca2+-binding sites of acid-sensing ion channel 1a. Open Biol 2024;14(6):240028
  285. Mordig M, Rätsch G, Kahles A. SimReadUntil for benchmarking selective sequencing algorithms on ONT devices. Bioinformatics 2024;40(5):btae199
  286. Moreno-Mayar JV, Sousa da Mota B, Higham T, Klemm S, Gorman Edmunds M, Stenderup J, Iraeta-Orbegozo M, Laborde V, Heyer E, Torres Hochstetter F, Friess M, Allentoft ME, Schroeder H, Delaneau O, Malaspinas AS. Ancient Rapanui genomes reveal resilience and pre-European contact with the Americas. Nature 2024;633(8029):389-397
  287. Moro G, Mallona I, Maillard J, Brügger MD, Fazilaty H, Szabo Q, Valenta T, Handler K, Kerlin F, Moor AE, Zinzen R, Robinson MD, Brunner E, Basler K. RoCK and ROI: Single-cell transcriptomics with multiplexed enrichment of selected transcripts and region-specific sequencing 2024
  288. Mottaz A, Savic B, Allaman L, Guggisberg AG. Neural correlates of motor learning: Network communication versus local oscillations. Netw Neurosci 2024;8(3):714-733
  289. Mottin L, Naderi N, Mottaz A, Michel PA, Been G, Johansson L, Swertz M, Stubbs A, Pasche E, Gobeill J, Ruch P. Comparing Sequence-Based and Literature-Based Pathogenicity Scoring Methods for Human Variants. Stud Health Technol Inform 2024;316:1684-1688
  290. Mozun R, Belle FN, Agostini A, Baumgartner MR, Fellay J, Forrest CB, Froese DS, Giannoni E, Goetze S, Hofmann K, Latzin P, Lauener R, Martin Necker A, Ormond K, Pachlopnik Schmid J, Pedrioli PGA, Posfay-Barbe KM, Rauch A, M Schulzke S, Stocker M, Spycher BD, Vayena E, Welzel T, Zamboni N, Vogt JE, Schlapbach LJ, Bielicki JA, Kuehni CE, SwissPedHealth consortium.Paediatric Personalized Research Network Switzerland (SwissPedHealth): a joint paediatric national data stream. BMJ Open 2024;14(12):e091884
  291. Muigg V, Seth-Smith HMB, Adam KM, Weisser M, Hinić V, Blaich A, Roloff T, Heininger U, Schmid H, Kohler M, Graf L, Winterflood DM, Schlaepfer P, Goldenberger D. Novel Organism Verification and Analysis (NOVA) study: identification of 35 clinical isolates representing potentially novel bacterial taxa using a pipeline based on whole genome sequencing. BMC Microbiol2024;24(1):14
  292. Mustafa H, Karasikov M, Mansouri Ghiasi N, Rätsch G, Kahles A. Label-guided seed-chain-extend alignment on annotated De Bruijn graphs. Bioinformatics 2024;40(suppl 1):i337-i346
  293. Mutschler E, Roloff T, Neves A, Vangstein Aamot H, Rodriguez-Sanchez B, Ramirez M, Rossen J, Couto N, Novais Â, Howden BP, Brisse S, Reuter S, Nolte O, Egli A, Seth-Smith HMB, ESCMID Study Group for Epidemiological Markers (ESGEM), and ESCMID Study Group for Genomic and Molecular Diagnostics (ESGMD). Towards unified reporting of genome sequencing results in clinical microbiology. PeerJ 2024;12:e17673
  294. Nadeau S, Devaux AJ, Bagutti C, Alt M, Ilg Hampe E, Kraus M, Würfel E, Koch KN, Fuchs S, Tschudin-Sutter S, Holschneider A, Ort C, Chen C, Huisman JS, Julian TR, Stadler T. Influenza transmission dynamics quantified from RNA in wastewater in Switzerland. Swiss Med Wkly 2024;154:3503
  295. Nagarathinam K, Scheck A, Labuhn M, Ströh LJ, Herold E, Veselkova B, Tune S, Cramer JT, Rosset S, Vollers SS, Bankwitz D, Ballmaier M, Böning H, Roth E, Khera T, Ahsendorf-Abidi HP, Dittrich-Breiholz O, Obleser J, Nassal M, Jäck HM, Pietschmann T, Correia BE, Krey T. Epitope-focused immunogens targeting the hepatitis C virus glycoproteins induce broadly neutralizing antibodies. Sci Adv 2024;10(49):eado2600
  296. Nahar S, Morales Moya LJ, Brunner J, Hendriks GJ, Towbin B, Hauser YP, Brancati G, Gaidatzis D, Großhans H. Dynamics of miRNA accumulation during C. elegans larval development.Nucleic Acids Res 2024;52(9):5336-5355
  297. Natali EN, Horst A, Meier P, Greiff V, Nuvolone M, Babrak LM, Fink K, Miho E. The dengue-specific immune response and antibody identification with machine learning. NPJ Vaccines2024;9(1):16
  298. Natali EN, Horst A, Meier P, Greiff V, Nuvolone M, Babrak LM, Fink K, Miho E. Author Correction: The dengue-specific immune response and antibody identification with machine learning.NPJ Vaccines 2024;9(1):30
  299. Natali EN, Horst A, Meier P, Greiff V, Nuvolone M, Babrak LM, Fink K, Miho E. Publisher Correction: The dengue-specific immune response and antibody identification with machine learning.NPJ Vaccines 2024;9(1):242
  300. Ndiaye M, Prieto-Baños S, Fitzgerald LM, Yazdizadeh Kharrazi A, Oreshkov S, Dessimoz C, Sedlazeck FJ, Glover N, Majidian S. When less is more: sketching with minimizers in genomics.Genome Biol 2024;25(1):270
  301. Neuner-Jehle N, Zeeb M, Thorball CW, Fellay J, Metzner KJ, Frischknecht P, Neumann K, Leeman C, Rauch A, Stöckle M, Huber M, Perreau M, Bernasconi E, Notter J, Hoffmann M, Leuzinger K, Günthard HF, Pasin C, Kouyos RD, Swiss HIV Cohort Study (SHCS). Using viral diversity to identify HIV-1 variants under HLA-dependent selection in a systematic viral genome-wide screen.PLoS Pathog 2024;20(8):e1012385
  302. Nevers Y, Warwick Vesztrocy A, Rossier V, Train CM, Altenhoff A, Dessimoz C, Glover NM. Quality assessment of gene repertoire annotations with OMArk. Nat Biotechnol 2025;43(1):124-133
  303. Niarakis A, Laubenbacher R, An G, Ilan Y, Fisher J, Flobak Å, Reiche K, Rodríguez Martínez M, Geris L, Ladeira L, Veschini L, Blinov ML, Messina F, Fonseca LL, Ferreira S, Montagud A, Noël V, Marku M, Tsirvouli E, Torres MM, Harris LA, Sego TJ, Cockrell C, Shick AE, Balci H, Salazar A, Rian K, Hemedan AA, Esteban-Medina M, Staumont B, Hernandez-Vargas E, Martis B S, Madrid-Valiente A, Karampelesis P, Sordo Vieira L, Harlapur P, Kulesza A, Nikaein N, Garira W, Malik Sheriff RS, Thakar J, Tran VDT, Carbonell-Caballero J, Safaei S, Valencia A, Zinovyev A, Glazier JA. Immune digital twins for complex human pathologies: applications, limitations, and challenges. NPJ Syst Biol Appl 2024;10(1):141
  304. Nonchev K, Andani S, Ficek-Pascual J, Nowak M, Sobottka B, Tumor Profiler Consortium, Koelzer VH, Raetsch G. Representation learning for multi-modal spatially resolved transcriptomics data 2024
  305. Noonan VK, Humphreys S, Biering-Sørensen F, Charlifue S, Chen Y, Guest JD, Jones LAT, French J, Widerström-Noga E, Lemmon VP, Heinemann AW, Schwab JM, Phillips AA, Rizi MM, Kramer JLK, Jutzeler CR, Torres-Espin A. Enhancing data standards to advance translation in spinal cord injury. Exp Neurol 2025;384:115048
  306. Ohsawa S, Schwaiger M, Iesmantavicius V, Hashimoto R, Moriyama H, Matoba H, Hirai G, Sodeoka M, Hashimoto A, Matsuyama A, Yoshida M, Yashiroda Y, Bühler M. Nitrogen signaling factor triggers a respiration-like gene expression program in fission yeast. EMBO J 2024;43(20):4604-4624
  307. Okur Z, Schlauri N, Bitsikas V, Panopoulou M, Ortiz R, Schwaiger M, Karmakar K, Schreiner D, Scheiffele P. Control of neuronal excitation-inhibition balance by BMP-SMAD1 signalling.Nature 2024;629(8011):402-409
  308. Oliveira S, Marchi N, Excoffier L. Assessing the limits of local ancestry inference from small reference panels. Mol Ecol Resour 2024;24(6):e13981
  309. Omenn GS, Lane L, Overall CM, Lindskog C, Pineau C, Packer NH, Cristea IM, Weintraub ST, Orchard S, Roehrl MHA, Nice E, Guo T, Van Eyk JE, Liu S, Bandeira N, Aebersold R, Moritz RL, Deutsch EW. The 2023 Report on the Proteome from the HUPO Human Proteome Project. J Proteome Res 2024;23(2):532-549
  310. Omenn GS, Orchard S, Lane L, Lindskog C, Pineau C, Overall CM, Budnik B, Mudge JM, Packer NH, Weintraub ST, Roehrl MHA, Nice E, Guo T, Van Eyk JE, Völker U, Zhang G, Bandeira N, Aebersold R, Moritz RL, Deutsch EW. The 2024 Report on the Human Proteome from the HUPO Human Proteome Project. J Proteome Res 2024;23(12):5296-5311
  311. Onder L, Papadopoulou C, Lütge A, Cheng HW, Lütge M, Perez-Shibayama C, Gil-Cruz C, De Martin A, Kurz L, Cadosch N, Pikor NB, Rodriguez R, Born D, Jochum W, Leskow P, Dutly A, Robinson MD, Ludewig B. Fibroblastic reticular cells generate protective intratumoral T cell environments in lung cancer. Cell 2025;188(2):430-446.e20
  312. Oreshkov S, Lepik K, Santoni F. pyTWMR: transcriptome-wide Mendelian randomization in python. Bioinformatics 2024;40(8):btae505
  313. Ormond KE, Bavamian S, Becherer C, Currat C, Joerger F, Geiger TR, Hiendlmeyer E, Maurer J, Staub T, Vayena E. What are the bottlenecks to health data sharing in Switzerland? An interview study. Swiss Med Wkly 2024;154:3538
  314. Ortín Vela S, Beyeler MJ, Trofimova O, Iuliani I, Vargas Quiros JD, de Vries VA, Meloni I, Elwakil A, Hoogewoud F, Liefers B, Presby D, Ramdas WD, Tomasoni M, Schlingemann R, Klaver CCW, Bergmann S. Phenotypic and genetic characteristics of retinal vascular parameters and their association with diseases. Nat Commun 2024;15(1):9593
  315. Ory F, Dietemann V, Guisolan A, Ah UV, Fleuti C, Michellod E, Schumpp O, Oberhaensli S, Charrière JD, Dainat B. Corrigendum: Paenibacillus melissococcoides sp. nov., isolated from a honey bee colony affected by European foulbrood disease. Int J Syst Evol Microbiol 2024;74(6)
  316. Oscarsson J, Bao K, Shiratsuchi A, Grossmann J, Wolski W, Aung KM, Lindholm M, Johansson A, Mowsumi FR, Wai SN, Belibasakis GN, Bostanci N. Bacterial symbionts in oral niche use type VI secretion nanomachinery for fitness increase against pathobionts. iScience 2024;27(5):109650
  317. Oscarsson J, Bao K, Shiratsuchi A, Grossmann J, Wolski W, Aung KM, Lindholm M, Johansson A, Mowsumi FR, Wai SN, Belibasakis GN, Bostanci N. Protocol for analyzing the function of the type VI secretion system of the oral symbiont Aggregatibacter aphrophilus in targeting pathobionts. STAR Protoc 2024;5(4):103415
  318. Otto SB, Servajean R, Lemopoulos A, Bitbol AF, Blokesch M. Interactions between pili affect the outcome of bacterial competition driven by the type VI secretion system. Curr Biol2024;34(11):2403-2417.e9
  319. Pacesa M, Pelea O, Jinek M. Past, present, and future of CRISPR genome editing technologies. Cell 2024;187(5):1076-1100
  320. Paloots R, Baudis M. cancercelllines.org-a novel resource for genomic variants in cancer cell lines. Database (Oxford) 2024;2024:baae030
  321. Pantolini L, Studer G, Pereira J, Durairaj J, Tauriello G, Schwede T. Embedding-based alignment: combining protein language models with dynamic programming alignment to detect structural similarities in the twilight-zone. Bioinformatics 2024;40(1):btad786
  322. Perez MAS, Chiffelle J, Bobisse S, Mayol-Rullan F, Bugnon M, Bragina ME, Arnaud M, Sauvage C, Barras D, Laniti DD, Huber F, Bassani-Sternberg M, Coukos G, Harari A, Zoete V. Predicting Antigen-Specificities of Orphan T Cell Receptors from Cancer Patients with TCRpcDist. Adv Sci (Weinh) 2024;11(40):e2405949
  323. Perriot S, Jones S, Genolet R, Mathias A, Lindsay H, Bobisse S, Liberto GD, Canales M, Queiroz L, Sauvage C, Wagner I, Oberholster L, Gimenez M, Bégarie D, Théaudin M, Pot C, Merkler D, Gottardo R, Harari A, Pasquier RD. KIR3DL1 and Tox identify clonally expanded encephalitogenic neuron-specific CD8+ T cells in autoimmune encephalitis 2024
  324. Peyvandi S, Bulliard M, Yilmaz A, Kauzlaric A, Marcone R, Haerri L, Coquoz O, Huang YT, Duffey N, Gafner L, Lorusso G, Fournier N, Lan Q, Rüegg C. Tumor-educated Gr1+CD11b+ cells drive breast cancer metastasis via OSM/IL-6/JAK-induced cancer cell plasticity. J Clin Invest 2024;134(6):e166847
  325. Pinjusic K, Ambrosini G, Lourenco J, Fournier N, Iseli C, Guex N, Egorova O, Nassiri S, Constam DB. Inhibition of anti-tumor immunity by melanoma cell-derived Activin-A depends on STING.Front Immunol 2023;14:1335207
  326. Piras M, Lin J, Sadler MC, Ranjbar S, Grosu C, Laaboub N, Preisig M, Gamma F, Plessen KJ, von Gunten A, Conus P, Kutalik Z, Eap CB. Psychotropic-induced weight gain and telomere length: results from a one-year longitudinal study and a large population-based cohort. Transl Psychiatry 2024;14(1):471
  327. Pushkarev O, van Mierlo G, Kribelbauer JF, Saelens W, Gardeux V, Deplancke B. Non-coding variants impact cis-regulatory coordination in a cell type-specific manner. Genome Biol2024;25(1):190
  328. Pérez-Llorca M, Hewett A, de la Peña Pita A, Hailer F, Sánchez Vilas J. Sexual dimorphism at different life stages: early life sexual differences in root growth in Silene latifolia. Plant Biol (Stuttg) 2024;26(7):1175-1184
  329. Pétremand R, Chiffelle J, Bobisse S, Perez MAS, Schmidt J, Arnaud M, Barras D, Lozano-Rabella M, Genolet R, Sauvage C, Saugy D, Michel A, Huguenin-Bergenat AL, Capt C, Moore JS, De Vito C, Labidi-Galy SI, Kandalaft LE, Dangaj Laniti D, Bassani-Sternberg M, Oliveira G, Wu CJ, Coukos G, Zoete V, Harari A. Identification of clinically relevant T cell receptors for personalized T cell therapy using combinatorial algorithms. Nat Biotechnol 2024
  330. Pétremand R, Chiffelle J, Bobisse S, Perez MAS, Schmidt J, Arnaud M, Barras D, Lozano-Rabella M, Genolet R, Sauvage C, Saugy D, Michel A, Huguenin-Bergenat AL, Capt C, Moore JS, De Vito C, Labidi-Galy SI, Kandalaft LE, Dangaj Laniti D, Bassani-Sternberg M, Oliveira G, Wu CJ, Coukos G, Zoete V, Harari A. Author Correction: Identification of clinically relevant T cell receptors for personalized T cell therapy using combinatorial algorithms. Nat Biotechnol 2024
  331. Racle J, Gfeller D. How to Predict Binding Specificity and Ligands for New MHC-II Alleles with MixMHC2pred. Methods Mol Biol 2024;2809:215-235
  332. Rai S, Zhang Y, Grockowiak E, Kimmerlin Q, Hansen N, Stoll C, Usart M, Luque Paz D, Hao-Shen H, Zhu Y, Roux J, Bader M, Dirnhofer S, Farady C, Schroeder T, Méndez-Ferrer S, Skoda R. IL-1β promotes MPN disease initiation by favoring early clonal expansion of JAK2-mutant hematopoietic stem cells Blood Adv 2024;8(5):1234-1249
  333. Rai S, Zhang Y, Grockowiak E, Kimmerlin Q, Hansen N, Stoll CB, Usart M, Luque Paz D, Hao-Shen H, Zhu Y, Roux J, Bader MS, Dirnhofer S, Farady CJ, Schroeder T, Méndez-Ferrer S, Skoda RC. IL-1β promotes MPN disease initiation by favoring early clonal expansion of JAK2-mutant hematopoietic stem cells. Blood Adv 2024;8(5):1234-1249
  334. Raney BJ, Barber GP, Benet-Pagès A, Casper J, Clawson H, Cline MS, Diekhans M, Fischer C, Navarro Gonzalez J, Hickey G, Hinrichs AS, Kuhn RM, Lee BT, Lee CM, Le Mercier P, Miga KH, Nassar LR, Nejad P, Paten B, Perez G, Schmelter D, Speir ML, Wick BD, Zweig AS, Haussler D, Kent WJ, Haeussler M. The UCSC Genome Browser database: 2024 update. Nucleic Acids Res2024;52(d1):D1082-D1088
  335. Redelings BD, Holmes I, Lunter G, Pupko T, Anisimova M. Insertions and Deletions: Computational Methods, Evolutionary Dynamics, and Biological Applications. Mol Biol Evol2024;41(9):msae177
  336. Redmer T, Raigel M, Sternberg C, Ziegler R, Probst C, Lindner D, Aufinger A, Limberger T, Trachtova K, Kodajova P, Högler S, Schlederer M, Stoiber S, Oberhuber M, Bolis M, Neubauer HA, Miranda S, Tomberger M, Harbusch NS, Garces de Los Fayos Alonso I, Sternberg F, Moriggl R, Theurillat JP, Tichy B, Bystry V, Persson JL, Mathas S, Aberger F, Strobl B, Pospisilova S, Merkel O, Egger G, Lagger S, Kenner L. JUN mediates the senescence associated secretory phenotype and immune cell recruitment to prevent prostate cancer progression. Mol Cancer2024;23(1):114
  337. Reyna-Blanco CS, Caduff M, Galimberti M, Leuenberger C, Wegmann D. Inference of Locus-Specific Population Mixtures from Linked Genome-Wide Allele Frequencies. Mol Biol Evol2024;41(7):msae137
  338. Rhodes VL, Waterhouse RM, Michel K. The molecular toll pathway repertoire in anopheline mosquitoes. Dev Comp Immunol 2025;162:105287
  339. Riccio C, Jansen ML, Guo L, Ziegler A. Variant effect predictors: a systematic review and practical guide. Hum Genet 2024;143(5):625-634
  340. Riccio C, Jansen ML, Thalén F, Koliopanos G, Link V, Ziegler A. Assessment of the functionality and usability of open-source rare variant analysis pipelines. Brief Bioinform 2024;26(1):bbaf044
  341. Richards TA, Eme L, Archibald JM, Leonard G, Coelho SM, de Mendoza A, Dessimoz C, Dolezal P, Fritz-Laylin LK, Gabaldón T, Hampl V, Kops GJPL, Leger MM, Lopez-Garcia P, McInerney JO, Moreira D, Muñoz-Gómez SA, Richter DJ, Ruiz-Trillo I, Santoro AE, Sebé-Pedrós A, Snel B, Stairs CW, Tromer EC, van Hooff JJE, Wickstead B, Williams TA, Roger AJ, Dacks JB, Wideman JG.Reconstructing the last common ancestor of all eukaryotes. PLoS Biol 2024;22(11):e3002917
  342. Robinson MD, Cai P, Emons M, Gerber R, Germain PL, Gunz S, Luo S, Moro G, Sonder E, Sonrel A, Wang J, Wissel D, Mallona I. Ten simple rules for computational biologists collaborating with wet lab researchers. PLoS Comput Biol 2024;20(6):e1012174
  343. Roder T, Pimentel G, Fuchsmann P, Stern MT, von Ah U, Vergères G, Peischl S, Brynildsrud O, Bruggmann R, Bär C. Scoary2: rapid association of phenotypic multi-omics data with microbial pan-genomes. Genome Biol 2024;25(1):93
  344. Roma L, Ercan C, Conticelli F, Akyürek N, Savic Prince S, Mertz KD, Diebold J, Lardinois D, Piscuoglio S, Ng CK, Bubendorf L. Tracing Tumor Heterogeneity of Pleomorphic Carcinoma of the Lung. J Thorac Oncol 2024;19(9):1284-1296
  345. Ross KE, Bastian FB, Buys M, Cook CE, D'Eustachio P, Harrison M, Hermjakob H, Li D, Lord P, Natale DA, Peters B, Sternberg PW, Su AI, Thakur M, Thomas PD, Bateman A, and the UniProt Consortium . Perspectives on tracking data reuse across biodata resources. Bioinform Adv 2024;4(1):vbae057
  346. Rossier V, Train C, Nevers Y, Robinson-Rechavi M, Dessimoz C. Matreex: Compact and Interactive Visualization for Scalable Studies of Large Gene Families. Genome Biol Evol2024;16(6):evae100
  347. Rozhoňová H, Martí-Gómez C, McCandlish DM, Payne JL. Robust genetic codes enhance protein evolvability. PLoS Biol 2024;22(5):e3002594
  348. Rubino V, Hüppi M, Höpner S, Tortola L, Schnüriger N, Legenne H, Taylor L, Voggensperger S, Keller I, Bruggman R, Kronig MN, Bacher U, Kopf M, Ochsenbein AF, Riether C. IL-21/IL-21R signaling renders acute myeloid leukemia stem cells more susceptible to cytarabine treatment and CAR T cell therapy. Cell Rep Med 2024;5(11):101826
  349. Runser S, Vetter R, Iber D. SimuCell3D: three-dimensional simulation of tissue mechanics with cell polarization. Nat Comput Sci 2024;4(4):299-309
  350. Runser S, Vetter R, Iber D. Publisher Correction: SimuCell3D: three-dimensional simulation of tissue mechanics with cell polarization. Nat Comput Sci 2024;4(5):379
  351. Rupasinghe M, Bersaglieri C, Leslie Pedrioli DM, Pedrioli PG, Panatta M, Hottiger MO, Cinelli P, Santoro R. PRAMEL7 and CUL2 decrease NuRD stability to establish ground-state pluripotency. EMBO Rep 2024;25(3):1453-1468
  352. Rupp K, Lösch A, Hu YL, Nie C, Schill R, Klever M, Pfahler S, Grasedyck L, Wettig T, Beerenwinkel N, Spang R. Modeling metastatic progression from cross-sectional cancer genomics data.Bioinformatics 2024;40(suppl 1):i140-i150
  353. Sadler MC, Apostolov A, Cevallos C, Ribeiro DM, Altman RB, Kutalik Z. Leveraging large-scale biobank EHRs to enhance pharmacogenetics of cardiometabolic disease medications 2024
  354. Sakenova N, Cacace E, Orakov A, Huber F, Varik V, Kritikos G, Michiels J, Bork P, Cossart P, Goemans CV, Typas A. Systematic mapping of antibiotic cross-resistance and collateral sensitivity with chemical genetics. Nat Microbiol 2025;10(1):202-216
  355. Santamaria-Martínez A, Epiney J, Srivastava D, Tavernari D, Varrone M, Milowich D, Letovanec I, Krueger T, Duran R, Ciriello G, Cairoli A, Oricchio E. Development of patient-derived lymphomoids with preserved tumor architecture for lymphoma therapy screening. Nat Commun 2024;15(1):10650
  356. Santos-Durán GN, Cooper RL, Jahanbakhsh E, Timin G, Milinkovitch MC. Self-organized patterning of crocodile head scales by compressive folding. Nature 2025;637(8045):375-383
  357. Satitsuksanoa P, van de Veen W, Tan G, Lopez JF, Wirz O, Jansen K, Sokolowska M, Mirer D, Globinska A, Boonpiyathad T, Schneider SR, Barletta E, Spits H, Chang I, Babayev H, Tahralı İ, Deniz G, Yücel EÖ, Kıykım A, Boyd SD, Akdis CA, Nadeau K, Akdis M. Allergen-specific B cell responses in oral immunotherapy-induced desensitization, remission, and natural outgrowth in cow's milk allergy. Allergy 2025;80(1):161-180
  358. Schaffer AM, Fiala GJ, Hils M, Natali E, Babrak L, Herr LA, Romero-Mulero MC, Cabezas-Wallscheid N, Rizzi M, Miho E, Schamel WWA, Minguet S. Kidins220 regulates the development of B cells bearing the λ light chain. Elife 2024;13:e83943
  359. Schmidli TS, Sigg S, Keihani S, Bosshard L, Prummer M, Nowag AS, Birzele J, Zhang C, Myers JB, Strebel RT. External validation of the MiGUTS nomogram for the prediction of bleeding control intervention after renal trauma. World J Urol 2024;42(1):554
  360. Schmidt TSB, Fullam A, Ferretti P, Orakov A, Maistrenko OM, Ruscheweyh HJ, Letunic I, Duan Y, Van Rossum T, Sunagawa S, Mende DR, Finn RD, Kuhn M, Pedro Coelho L, Bork P. SPIRE: a Searchable, Planetary-scale mIcrobiome REsource. Nucleic Acids Res 2024;52(d1):D777-D783
  361. Schmutzer M, Dasmeh P, Wagner A. Frustration can Limit the Adaptation of Promiscuous Enzymes Through Gene Duplication and Specialisation. J Mol Evol 2024;92(2):104-120
  362. Schnider B, M'Rad Y, El Ahmadie J, de Brevern AG, Imberty A, Lisacek F. HumanLectome, an update of UniLectin for the annotation and prediction of human lectins. Nucleic Acids Res2024;52(d1):D1683-D1693
  363. Schoeler T, Pingault JB, Kutalik Z. The impact of self-report inaccuracy in the UK Biobank and its interplay with selective participation. Nat Hum Behav 2024
  364. Schrempft S, Trofimova O, Künzi M, Ramponi C, Lutti A, Kherif F, Latypova A, Vollenweider P, Marques-Vidal P, Preisig M, Kliegel M, Stringhini S, Draganski B. The Neurobiology of Life Course Socioeconomic Conditions and Associated Cognitive Performance in Middle to Late Adulthood. J Neurosci 2024;44(17):e1231232024
  365. Schwab J, Foglierini M, Pescosolido E, Pacheco I, Ruiz Buendía GA, Madelon N, Pellaton C, Banderet V, Ribi C, Bergmann MM, Didierlaurent AM, Fenwick C, Duperrex O, Muller YD. Features of chronic urticaria after COVID-19 mRNA vaccine over time. Commun Med (Lond) 2024;4(1):254
  366. Schwaiger M, Mohn F, Bühler M, Kaaij LJT. guidedNOMe-seq quantifies chromatin states at single allele resolution for hundreds of custom regions in parallel. BMC Genomics 2024;25(1):732
  367. Schwede M, Jahn K, Kuipers J, Miles LA, Bowman RL, Robinson T, Furudate K, Uryu H, Tanaka T, Sasaki Y, Ediriwickrema A, Benard B, Gentles AJ, Levine R, Beerenwinkel N, Takahashi K, Majeti R. Mutation order in acute myeloid leukemia identifies uncommon patterns of evolution and illuminates phenotypic heterogeneity. Leukemia 2024;38(7):1501-1510
  368. Schweke H, Pacesa M, Levin T, Goverde CA, Kumar P, Duhoo Y, Dornfeld LJ, Dubreuil B, Georgeon S, Ovchinnikov S, Woolfson DN, Correia BE, Dey S, Levy ED. An atlas of protein homo-oligomerization across domains of life. Cell 2024;187(4):999-1010.e15
  369. Schütz SD, Brackmann M, Liechti N, Moser M, Wittwer M, Bruggmann R. Functional characterization of Francisella tularensis subspecies holarctica genotypes during tick cell and macrophage infections using a proteogenomic approach. Front Cell Infect Microbiol 2024;14:1355113
  370. Seidel S, Stadler T, Vaughan TG. Estimating pathogen spread using structured coalescent and birth-death models: A quantitative comparison. Epidemics 2024;49:100795
  371. Semilietof A, Stefanidis E, Gray-Gaillard E, Pujol J, D'Esposito A, Reichenbach P, Guillaume P, Zoete V, Irving M, Michielin O. Preclinical model for evaluating human TCRs against chimeric syngeneic tumors. J Immunother Cancer 2024;12(12):e009504
  372. Sempach L, Doll JPK, Limbach V, Marzetta F, Schaub AC, Schneider E, Kettelhack C, Mählmann L, Schweinfurth-Keck N, Ibberson M, Lang UE, Schmidt A. Examining immune-inflammatory mechanisms of probiotic supplementation in depression: secondary findings from a randomized clinical trial. Transl Psychiatry 2024;14(1):305
  373. Sen S, Deupi X. Study of Photoselectivity in Linear Conjugated Chromophores Using the XMS-CASPT2 Method. ACS Phys Chem Au 2024;4(6):736-749
  374. Serrano MJ, Goudet J, Cumer T. Characterization of the diversity of barn owl's mitochondrial genome reveals high copy number variations in the control region. PLoS One2024;19(1):e0295595
  375. Seyres D, Gorka O, Schmidt R, Marone R, Zavolan M, Jeker LT. T helper cells exhibit a dynamic and reversible 3'-UTR landscape. RNA 2024;30(4):418-434
  376. Sharma S, Dong Q, Haid M, Adam J, Bizzotto R, Fernandez-Tajes JJ, Jones AG, Tura A, Artati A, Prehn C, Kastenmüller G, Koivula RW, Franks PW, Walker M, Forgie IM, Giordano G, Pavo I, Ruetten H, Dermitzakis M, McCarthy MI, Pedersen O, Schwenk JM, Tsirigos KD, De Masi F, Brunak S, Viñuela A, Mari A, McDonald TJ, Kokkola T, Adamski J, Pearson ER, Grallert H. Role of human plasma metabolites in prediabetes and type 2 diabetes from the IMI-DIRECT study. Diabetologia 2024;67(12):2804-2818
  377. Sigal A, Neher RA, Lessells RJ. The consequences of SARS-CoV-2 within-host persistence. Nat Rev Microbiol 2024
  378. Signal B, Phipps AJ, Giles KA, Huskins SN, Mercer TR, Robinson MD, Woodhouse A, Taberlay PC. Ageing-Related Changes to H3K4me3, H3K27ac, and H3K27me3 in Purified Mouse Neurons.Cells 2024;13(16):1393
  379. Silvestro D, Latrille T, Salamin N. Toward a Semi-Supervised Learning Approach to Phylogenetic Estimation. Syst Biol 2024;73(5):789-806
  380. Simoes MP, Hodcroft EB, Simmonds P, Albert J, Alidjinou EK, Ambert-Balay K, Andrés C, Antón A, Auvray C, Bailly JL, Baldanti F, Bastings C, Beard S, Berengua C, Berginc N, Bloemen M, Blomqvist S, Bosma F, Böttcher S, Bubba L, Buderus S, Cabrerizo M, Calvo C, Celma C, Ceriotti F, Clark G, Costa I, Coste-Burel M, Couderé K, Cremer J, Del Cuerpo Casas M, Daehne T, de Beer J, de Ceano-Vivas M, De Gascun C, de Rougemont A, Dean J, Dembinski JL, Diedrich S, Diez-Domingo J, Dillner L, Dorenberg DH, Ducancelle A, Dudman S, Dyrdak R, Eis-Huebinger AM, Falces-Romero I, Farkas A, Feeney S, Fernandez-Garcia MD, Flipse J, Franck KT, Galli C, Garrigue I, Geeraedts F, Georgieva I, Giardina F, Guiomar R, Hauzenberger E, Heikens E, Henquell C, Hober D, Hönemann M, Howson-Wells H, Hruškar Ž, Ikonen N, Imbert B, Jansz AR, Jeannoël M, Jiřincová H, Josset L, Keeren K, Kramer-Lindhout N, Krokstad S, Lazrek M, Le Guillou-Guillemette H, Lefeuvre C, Lind A, Lunar MM, Maier M, Marque-Juillet S, McClure CP, McKenna J, Meijer A, Menasalvas Ruiz A, Mengual-Chuliá B, Midgley S, Mirand A, Molenkamp R, Montes M, Moreno-Docón A, Morley U, Murk JL, Navascués-Ortega A, Nijhuis R, Nikolaeva-Glomb L, Nordbø SA, Numanovic S, Oggioni M, Oñate Vergara E, Pacaud J, Pacreau ML, Panning M, Pariani E, Pekova L, Pellegrinelli L, Petrovec M, Pietsch C, Pilorge L, Piñeiro L, Piralla A, Poljak M, Prochazka B, Rabella N, Rahamat-Langendoen JC, Rainetova P, Reynders M, Riezebos-Brilman A, Roorda L, Savolainen-Kopra C, Schuffenecker I, Smeets LC, Stoyanova A, Stefic K, Swanink C, Tabain I, Tjhie J, Thouault L, Tumiotto C, Uceda Renteria S, Uršič T, Vallet S, Van Ranst M, Van Wunnik P, Verweij JJ, Vila J, Wintermans B, Wollants E, Wolthers KC, Xavier López-Labrador F, Fischer TK, Harvala H, Benschop KSM. Epidemiological and Clinical Insights into the Enterovirus D68 Upsurge in Europe 2021-2022 and Emergence of Novel B3-Derived Lineages, ENPEN Multicentre Study. J Infect Dis 2024;230(4):e917-e928
  381. Sintsova A, Ruscheweyh HJ, Field CM, Feer L, Nguyen BD, Daniel B, Hardt WD, Vorholt JA, Sunagawa S. mBARq: a versatile and user-friendly framework for the analysis of DNA barcodes from transposon insertion libraries, knockout mutants, and isogenic strain populations. Bioinformatics 2024;40(2):btae078
  382. Slieker RC, Münch M, Donnelly LA, Bouland GA, Dragan I, Kuznetsov D, Elders PJM, Rutter GA, Ibberson M, Pearson ER, 't Hart LM, van de Wiel MA, Beulens JWJ. An omics-based machine learning approach to predict diabetes progression: a RHAPSODY study. Diabetologia 2024;67(5):885-894
  383. Smith E, Paloots R, Giagkos D, Baudis M, Stockinger K. Data-driven information extraction and enrichment of molecular profiling data for cancer cell lines. Bioinform Adv 2024;4(1):vbae045
  384. Sobottka B, Vetter V, Banaei-Esfahani A, Nowak M, Lorch A, Sirek A, Mertz KD, Brunelli M, Berthold D, de Leval L, Kahraman A, Koelzer VH, Moch H. Immune Phenotype-Genotype Associations in Primary Clear Cell Renal Cell Carcinoma and Matched Metastatic Tissue. Mod Pathol 2024;37(10):100558
  385. Spriano F, Sartori G, Sgrignani J, Barnabei L, Arribas AJ, Guala M, Del Amor AMC, Tomasso MR, Tarantelli C, Cascione L, Golino G, Riveiro ME, Bortolozzi R, Lupia A, Paduano F, Huguet S, Rezai K, Rinaldi A, Margheriti F, Ventura P, Guarda G, Costa G, Rocca R, Furlan A, Verdonk LM, Innocenti P, Martin NI, Viola G, Driessen C, Zucca E, Stathis A, Gahtory D, Van den Nieuwboer M, Bornhauser B, Alcaro S, Trapasso F, Cristobal S, Padrick SB, Pazzi N, Cavalli F, Cavalli A, Gaudio E, Bertoni F. A first-in-class Wiskott-Aldrich syndrome protein activator with antitumor activity in hematologic cancers. Haematologica 2024;109(11):3602-3614
  386. Spriano F, Tarantelli C, Cascione L, Gaudio E, Golino G, Scalise L, Cacciapuoti MT, Zucca E, Stathis A, Van Berkel PH, Inghirami G, Zammarchi F, Bertoni F. Targeting CD25+ lymphoma cells with the antibody-drug conjugate camidanlumab tesirine as a single agent or in combination with targeted agents. Br J Haematol 2024;205(5):1873-1882
  387. Spörri L, Uldry AC, Kreuzer M, Herzog EL, Zinkernagel MS, Unterlauft JD, Zysset-Burri DC. Exploring the Ocular Surface Microbiome and Tear Proteome in Glaucoma. Int J Mol Sci2024;25(11):6257
  388. Sridhar S, Zhou Y, Ibrahim A, Bertazzo S, Wyss T, Swain A, Maheshwari U, Huang SF, Colonna M, Keller A. Targeting TREM2 signaling shows limited impact on cerebrovascular calcification.Life Sci Alliance 2025;8(1):e202402796
  389. Stefanidis E, Semilietof A, Pujol J, Seijo B, Scholten K, Zoete V, Michielin O, Sandaltzopoulos R, Coukos G, Irving M. Combining SiRPα decoy-coengineered T cells and antibodies augments macrophage-mediated phagocytosis of tumor cells. J Clin Invest 2024;134(11):e161660
  390. Stephenson JD, Totoo P, Burke DF, Jänes J, Beltrao P, Martin MJ. ProtVar: mapping and contextualizing human missense variation. Nucleic Acids Res 2024;52(w1):W140-W147
  391. Stockenhuber R, Akiyama R, Tissot N, Milosavljevic S, Yamazaki M, Wyler M, Arongaus AB, Podolec R, Sato Y, Widmer A, Ulm R, Shimizu KK. UV RESISTANCE LOCUS 8-Mediated UV-B Response Is Required Alongside CRYPTOCHROME 1 for Plant Survival in Sunlight under Field Conditions. Plant Cell Physiol 2024;65(1):35-48
  392. Subissi L, Otieno JR, Worp N, Attar Cohen H, Oude Munnink BB, Abu-Raddad LJ, Alm E, Barakat A, Barclay WS, Bhiman JN, Caly L, Chand M, Chen M, Cullinane A, de Oliveira T, Drosten C, Druce J, Effler P, El Masry I, Faye A, Ghedin E, Grant R, Haagmans BL, Happi C, Herring BL, Hodcroft EB, Ikejezie J, Katawera V, Kassamali ZA, Leo YS, Leung GM, Kondor RJ, Marklewitz M, Mendez-Rico J, Melhem NM, Munster V, Nahapetyan K, Naindoo D, Oh DY, Peacock TP, Peiris M, Peng Z, Poon LLM, Rambaut A, Saha S, Shen Y, Siqueira MM, Volz E, Tessema SK, Thiel V, Triki H, van der Werf S, von Eije K, Cunningham J, Koopmans MPG, von Gottberg A, Agrawal A, Van Kerkhove MD. An updated framework for SARS-CoV-2 variants reflects the unpredictability of viral evolution. Nat Med 2024;30(9):2400-2403
  393. Sutcliffe SG, Kraemer SA, Ellmen I, Knapp JJ, Overton AK, Nash D, Nissimov JI, Charles TC, Dreifuss D, Topolsky I, Baykal PI, Fuhrmann L, Jablonski KP, Beerenwinkel N, Levy JI, Olabode AS, Becker DG, Gugan G, Brintnell E, Poon AFY, Valieris R, Drummond RD, Defelicibus A, Dias-Neto E, Rosales RA, Tojal da Silva I, Orfanou A, Psomopoulos F, Pechlivanis N, Pipes L, Chen Z, Baaijens JA, Baym M, Shapiro BJ. Tracking SARS-CoV-2 variants of concern in wastewater: an assessment of nine computational tools using simulated genomic data. Microb Genom2024;10(5)
  394. Sánchez P, Coutinho FH, Sebastián M, Pernice MC, Rodríguez-Martínez R, Salazar G, Cornejo-Castillo FM, Pesant S, López-Alforja X, López-García EM, Agustí S, Gojobori T, Logares R, Sala MM, Vaqué D, Massana R, Duarte CM, Acinas SG, Gasol JM. Marine picoplankton metagenomes and MAGs from eleven vertical profiles obtained by the Malaspina Expedition. Sci Data2024;11(1):154
  395. Sélem-Mojica N, Karakulak T, Anjum A, Pashkov A, Pérez-Estrada R, Enriquez-Guillén K, DeBlasio D, Ferreira-Gonzalez S, Medina-Rivera A, Rodrigo-Torres D, Kilpatrick AM, Welch LR, Rahman F. Closing the computational biology 'knowledge gap': Spanish Wikipedia as a case study. Bioinformatics 2024;40(suppl 1):i11-i19
  396. Tarantelli C, Wald D, Munz N, Spriano F, Bruscaggin A, Cannas E, Cascione L, Gaudio E, Arribas AJ, Manjappa S, Golino G, Scalise L, Cacciapuoti MT, Zucca E, Stathis A, Inghirami G, Van Berkel PH, Rossi D, Caimi PF, Zammarchi F, Bertoni F. Targeting CD19-positive lymphomas with the antibodydrug conjugate loncastuximab tesirine: preclinical evidence of activity as a single agent and in combination therapy. Haematologica 2024;109(10):3314-3326
  397. Tavernari D, Borgeaud M, Liu X, Parikh K, Le X, Ciriello G, Addeo A. Decoding the Clinical and Molecular Signatures of EGFR Common, Compound, and Uncommon Mutations in NSCLC: A Brief Report. J Thorac Oncol 2024:S1556-0864(24)02531-0
  398. Tejero O, Pamula F, Koyanagi M, Nagata T, Afanasyev P, Das I, Deupi X, Sheves M, Terakita A, Schertler GFX, Rodrigues MJ, Tsai CJ. Active state structures of a bistable visual opsin bound to G proteins. Nat Commun 2024;15(1):8928
  399. Teleman M, Gabriel AAG, Hérault L, Gfeller D. SuperSpot: coarse graining spatial transcriptomics data into metaspots. Bioinformatics 2024;41(1):btae734
  400. Ten Donkelaar HJ, Baud R, Kachlik D. Towards a Terminologia Anatomica Humana. Anat Sci Int 2024;99(4):387-399
  401. Thormann K, Lüthi AS, Deniau F, Heider A, Cazzaniga S, Radonjic-Hoesli S, Lehmann M, Schlapbach C, Herzog EL, Kreuzer M, Zinkernagel MS, Akdis CA, Zysset-Burri DC, Simon HU, Simon D. Dupilumab-associated ocular surface disease is characterized by a shift from Th2/Th17 toward Th1/Th17 inflammation. Allergy 2024;79(4):937-948
  402. Tiberi S, Meili J, Cai P, Soneson C, He D, Sarkar H, Avalos-Pacheco A, Patro R, Robinson MD. DifferentialRegulation: a Bayesian hierarchical approach to identify differentially regulated genes.Biostatistics 2024;25(4):1079-1093
  403. Timasheva Y, Lepik K, Liska O, Papp B, Kutalik Z. Widespread natural selection on metabolite levels in humans. Genome Res 2024;34(8):1121-1129
  404. Topaloudis A, Lavanchy E, Cumer T, Ducrest A, Simon C, Machado AP, Paposhvili N, Roulin A, Goudet J. The recombination landscape of the barn owl, from families to populations 2024
  405. Toro S, Anagnostopoulos AV, Bello SM, Blumberg K, Cameron R, Carmody L, Diehl AD, Dooley DM, Duncan WD, Fey P, Gaudet P, Harris NL, Joachimiak MP, Kiani L, Lubiana T, Munoz-Torres MC, O'Neil S, Osumi-Sutherland D, Puig-Barbe A, Reese JT, Reiser L, Robb SM, Ruemping T, Seager J, Sid E, Stefancsik R, Weber M, Wood V, Haendel MA, Mungall CJ. Dynamic Retrieval Augmented Generation of Ontologies using Artificial Intelligence (DRAGON-AI). J Biomed Semantics 2024;15(1):19
  406. Torres-Puig S, Crespo-Pomar S, Akarsu H, Yimthin T, Cippà V, Démoulins T, Posthaus H, Ruggli N, Kuhnert P, Labroussaa F, Jores J. Functional surface expression of immunoglobulin cleavage systems in a candidate Mycoplasma vaccine chassis. Commun Biol 2024;7(1):779
  407. Tschan Y, Sasamalo M, Hiza H, Fellay J, Gagneux S, Reither K, Hella J, Portevin D. Diagnostic accuracy of a sequence-specific Mtb-DNA hybridization assay in urine: a case-control study including subclinical TB cases. Microbiol Spectr 2024;12(6):e0042624
  408. Tundo S, Trefny M, Rodić A, Grueninger O, Brodmann N, Börsch A, Serger C, Fürst J, Buchi M, Buczak K, Müller AT, Sach-Peltason L, Don L, Herzig P, Lardinois D, Heinzelmann-Schwarz V, Mertz KD, Hojski A, Schaeuble K, Laubli H, Natoli M, Toso A, Luu TT, Zippelius A, Romagnani A. Inhibition of Cbl-b restores effector functions of human intratumoral NK cells. J Immunother Cancer 2024;12(11):e009860
  409. Usart M, Hansen N, Stetka J, Almeida Fonseca T, Guy A, Kimmerlin Q, Rai S, Hao-Shen H, Roux J, Dirnhofer S, Skoda RC. The glutaminase inhibitor CB-839 targets metabolic dependencies of JAK2-mutant hematopoiesis in MPN. Blood Adv 2024;8(9):2312-2325
  410. Usart M, Stetka J, Luque Paz D, Hansen N, Kimmerlin Q, Almeida Fonseca T, Lock M, Kubovcakova L, Karjalainen R, Hao-Shen H, Börsch A, El Taher A, Schulz J, Leroux J, Dirnhofer S, Skoda R. Loss of Dnmt3a increases self-renewal and resistance to pegIFN-α in JAK2-V617F–positive myeloproliferative neoplasms∗ Blood 2024;143(24):2490-2503
  411. Usart M, Stetka J, Luque Paz D, Hansen N, Kimmerlin Q, Almeida Fonseca T, Lock M, Kubovcakova L, Karjalainen R, Hao-Shen H, Börsch A, El Taher A, Schulz J, Leroux JC, Dirnhofer S, Skoda RC. Loss of Dnmt3a increases self-renewal and resistance to pegIFN-α in JAK2-V617F-positive myeloproliferative neoplasms. Blood 2024;143(24):2490-2503
  412. Vacchini A, Chancellor A, Yang Q, Colombo R, Spagnuolo J, Berloffa G, Joss D, Øyås O, Lecchi C, De Simone G, Beshirova A, Nosi V, Loureiro JP, Morabito A, De Gregorio C, Pfeffer M, Schaefer V, Prota G, Zippelius A, Stelling J, Häussinger D, Brunelli L, Villalta P, Lepore M, Davoli E, Balbo S, Mori L, De Libero G. Nucleobase adducts bind MR1 and stimulate MR1-restricted T cells. Sci Immunol 2024;9(95):eadn0126
  413. Vale PD, Fotsing EDB, Mucyo SJP, Abwage WD, Dibakou SE, N'Goran KP, Sop T, van der Hoek Y, Heinicke S, Kulik L, Kone I, Kuehl H. Great ape abundance and per capita carbon storage in their habitats. BMC Ecol Evol 2024;24(1):137
  414. Vallat B, Webb BM, Westbrook JD, Goddard TD, Hanke CA, Graziadei A, Peisach E, Zalevsky A, Sagendorf J, Tangmunarunkit H, Voinea S, Sekharan M, Yu J, Bonvin AAMJJ, DiMaio F, Hummer G, Meiler J, Tajkhorshid E, Ferrin TE, Lawson CL, Leitner A, Rappsilber J, Seidel CAM, Jeffries CM, Burley SK, Hoch JC, Kurisu G, Morris K, Patwardhan A, Velankar S, Schwede T, Trewhella J, Kesselman C, Berman HM, Sali A. IHMCIF: An Extension of the PDBx/mmCIF Data Standard for Integrative Structure Determination Methods. J Mol Biol 2024;436(17):168546
  415. Vaughan TG, Scire J, Nadeau SA, Stadler T. Estimates of early outbreak-specific SARS-CoV-2 epidemiological parameters from genomic data. Proc Natl Acad Sci U S A2024;121(2):e2308125121
  416. Vaughan TG. ReMASTER: improved phylodynamic simulation for BEAST 2.7. Bioinformatics 2024;40(1):btae015
  417. Verbiest MA, Lundström O, Xia F, Baudis M, Bilgin Sonay T, Anisimova M. Short tandem repeat mutations regulate gene expression in colorectal cancer. Sci Rep 2024;14(1):3331
  418. Vetter R, Iber D. Reply to: Assessing the precision of morphogen gradients in neural tube development. Nat Commun 2024;15(1):930
  419. Villena-Alemany C, Mujakić I, Fecskeová LK, Woodhouse J, Auladell A, Dean J, Hanusová M, Socha M, Gazulla CR, Ruscheweyh HJ, Sunagawa S, Silva Kavagutti V, Andrei AŞ, Grossart HP, Ghai R, Koblížek M, Piwosz K. Phenology and ecological role of aerobic anoxygenic phototrophs in freshwaters. Microbiome 2024;12(1):65
  420. Volinsky-Fremond S, Horeweg N, Andani S, Barkey Wolf J, Lafarge MW, de Kroon CD, Ørtoft G, Høgdall E, Dijkstra J, Jobsen JJ, Lutgens LCHW, Powell ME, Mileshkin LR, Mackay H, Leary A, Katsaros D, Nijman HW, de Boer SM, Nout RA, de Bruyn M, Church D, Smit VTHBM, Creutzberg CL, Koelzer VH, Bosse T. Prediction of recurrence risk in endometrial cancer with multimodal deep learning. Nat Med 2024;30(7):1962-1973
  421. Volinsky-Fremond S, Horeweg N, Andani S, Barkey Wolf J, Lafarge MW, de Kroon CD, Ørtoft G, Høgdall E, Dijkstra J, Jobsen JJ, Lutgens LCHW, Powell ME, Mileshkin LR, Mackay H, Leary A, Katsaros D, Nijman HW, de Boer SM, Nout RA, de Bruyn M, Church D, Smit VTHBM, Creutzberg CL, Koelzer VH, Bosse T. Author Correction: Prediction of recurrence risk in endometrial cancer with multimodal deep learning. Nat Med 2024;30(7):2092
  422. Wagner A. Genotype sampling for deep-learning assisted experimental mapping of a combinatorially complete fitness landscape. Bioinformatics 2024;40(5):btae317
  423. Walter J, Colleoni S, Lazzari G, Fortes C, Grossmann J, Roschitzki B, Laczko E, Naegeli H, Bleul U, Galli C. Maturational competence of equine oocytes is associated with alterations in their 'cumulome'. Mol Hum Reprod 2024;30(9):gaae033
  424. Wang J, Beyer D, Vaccarin C, He Y, Tanriver M, Benoit R, Deupi X, Mu L, Bode JW, Schibli R, Müller C. Development of radiofluorinated MLN-4760 derivatives for PET imaging of the SARS-CoV-2 entry receptor ACE2. Eur J Nucl Med Mol Imaging 2024;52(1):9-21
  425. Wang J, Beyer D, Vaccarin C, He Y, Tanriver M, Benoit R, Deupi X, Mu L, Bode JW, Schibli R, Müller C. Development of radiofluorinated MLN-4760 derivatives for PET imaging of the SARS-CoV-2 entry receptor ACE2 2024
  426. Wang J, Crowell HL, Robinson MD. Disentangling cell type and state transcriptional programs 2024
  427. Wang X, Heckel G. Genome-wide relaxation of selection and the evolution of the island syndrome in Orkney voles. Genome Res 2024;34(6):851-862
  428. Waterhouse AM, Studer G, Robin X, Bienert S, Tauriello G, Schwede T. The structure assessment web server: for proteins, complexes and more. Nucleic Acids Res 2024;52(w1):W318-W323
  429. Watson SS, Zomer A, Fournier N, Lourenco J, Quadroni M, Chryplewicz A, Nassiri S, Aubel P, Avanthay S, Croci D, Abels E, Broekman MLD, Hanahan D, Huse JT, Daniel RT, Hegi ME, Homicsko K, Cossu G, Hottinger AF, Joyce JA. Fibrotic response to anti-CSF-1R therapy potentiates glioblastoma recurrence. Cancer Cell 2024;42(9):1507-1527.e11
  430. Wegmann R, Bankel L, Festl Y, Lau K, Lee S, Arnold F, Cappelletti V, Fehr A, Picotti P, Dedes KJ, Franzen D, Lenggenhager D, Bode PK, Zoche M, Moch H, Britschgi C, Snijder B. Molecular and functional landscape of malignant serous effusions for precision oncology. Nat Commun 2024;15(1):8544
  431. Wegmann R, Bonilla X, Casanova R, Chevrier S, Coelho R, Esposito C, Ficek-Pascual J, Goetze S, Gut G, Jacob F, Jacobs A, Kuipers J, Lischetti U, Mena J, Milani ES, Prummer M, Del Castillo JS, Singer F, Sivapatham S, Toussaint NC, Vilinovszki O, Wildschut MHE, Thavayogarajah T, Malani D, TumorProfiler Consortium, Aebersold R, Bacac M, Beerenwinkel N, Beisel C, Bodenmiller B, Heinzelmann-Schwarz V, Koelzer VH, Levesque MP, Moch H, Pelkmans L, Rätsch G, Tolnay M, Wicki A, Wollscheid B, Manz MG, Snijder B, Theocharides APA. Single-cell landscape of innate and acquired drug resistance in acute myeloid leukemia. Nat Commun 2024;15(1):9402
  432. Wegner F, Cabrera-Gil B, Tanguy A, Beckmann C, Beerenwinkel N, Bertelli C, Carrara M, Cerutti L, Chen C, Cordey S, Dumoulin A, du Plessis L, Friedli M, Gerth Y, Greub G, Härri A, Hirsch H, Howald C, Huber M, Imhof A, Kaiser L, Kufner V, Leib SL, Leuzinger K, Lleshi E, Martinetti G, Mäusezahl M, Moraz M, Neher R, Nolte O, Ramette A, Redondo M, Risch L, Rohner L, Roloff T, Schläepfer P, Schneider K, Singer F, Spina V, Stadler T, Studer E, Topolsky I, Trkola A, Walther D, Wohlwend N, Zehnder C, Neves A, Egli A, SPSP consortium. How much should we sequence? An analysis of the Swiss SARS-CoV-2 surveillance effort. Microbiol Spectr 2024;12(5):e0362823
  433. Weibel N, Curcio M, Schreiber A, Arriaga G, Mausy M, Mehdy J, Brüllmann L, Meyer A, Roth L, Flury T, Pecina V, Starlinger K, Dernič J, Jungfer K, Ackle F, Earp J, Hausmann M, Jinek M, Rogler G, Antunes Westmann C. Engineering a Novel Probiotic Toolkit in Escherichia coli Nissle 1917 for Sensing and Mitigating Gut Inflammatory Diseases. ACS Synth Biol 2024;13(8):2376-2390
  434. Weissbach FH, Follonier OM, Schmid S, Leuzinger K, Schmid M, Hirsch HH. Single-cell RNA-sequencing of BK polyomavirus replication in primary human renal proximal tubular epithelial cells identifies specific transcriptome signatures and a novel mitochondrial stress pattern. J Virol 2024;98(12):e0138224
  435. Wells CA, Guhr A, Bairoch A, Chen Y, Hu M, Löser P, Ludwig TE, Mah N, Mueller SC, Seiler Wulczyn AEM, Seltmann S, Rossbach B, Kurtz A. Guidelines for managing and using the digital phenotypes of pluripotent stem cell lines. Stem Cell Reports 2024;19(10):1369-1378
  436. Westmann CA, Goldbach L, Wagner A. The highly rugged yet navigable regulatory landscape of the bacterial transcription factor TetR. Nat Commun 2024;15(1):10745
  437. Wieboldt R, Sandholzer M, Carlini E, Lin CW, Börsch A, Zingg A, Lardinois D, Herzig P, Don L, Zippelius A, Läubli H, Mantuano NR. Engagement of sialylated glycans with Siglec receptors on suppressive myeloid cells inhibits anticancer immunity via CCL2. Cell Mol Immunol 2024;21(5):495-509
  438. Windels EM, Cool L, Persy E, Swinnen J, Matthay P, Van den Bergh B, Wenseleers T, Michiels J. Antibiotic dose and nutrient availability differentially drive the evolution of antibiotic resistance and persistence. ISME J 2024;18(1):wrae070
  439. Windels EM, Wampande EM, Joloba ML, Boom WH, Goig GA, Cox H, Hella J, Borrell S, Gagneux S, Brites D, Stadler T. HIV co-infection is associated with reduced Mycobacterium tuberculosis transmissibility in sub-Saharan Africa. PLoS Pathog 2024;20(5):e1011675
  440. Wissel D, Janakarajan N, Schulte J, Rowson D, Yuan X, Boeva V. sparsesurv: a Python package for fitting sparse survival models via knowledge distillation. Bioinformatics 2024;40(9):btae521
  441. Witting M, Malik A, Leach A, Bridge A, Aimo L, Conroy MJ, O'Donnell VB, Hoffmann N, Kopczynski D, Giacomoni F, Paulhe N, Gassiot AC, Poupin N, Jourdan F, Bertrand-Michel J. Challenges and perspectives for naming lipids in the context of lipidomics. Metabolomics 2024;20(1):15
  442. Wosny M, Aeppli S, Fischer S, Peres T, Rothermundt C, Hastings J. Factors Guiding Clinical Decision-Making in Genitourinary Oncology. Cancer Med 2024;13(20):e70304
  443. Wosny M, Hastings J. Applying Large Language Models to Interpret Qualitative Interviews in Healthcare. Stud Health Technol Inform 2024;316:791-795
  444. Wosny M, Strasser LM, Kraehenmann S, Hastings J. Practical Recommendations for Navigating Digital Tools in Hospitals: Qualitative Interview Study. JMIR Med Educ 2024;10:e60031
  445. Xu J, Chen G, Wang H, Cao S, Heng J, Deupi X, Du Y, Kobilka BK. Calcineurin-fusion facilitates cryo-EM structure determination of a Family A GPCR. Proc Natl Acad Sci U S A2024;121(48):e2414544121
  446. Xu ZM, Gnouamozi GE, Rüeger S, Shea PR, Buti M, Chan HL, Marcellin P, Lawless D, Naret O, Zeller M, Schneuing A, Scheck A, Junier T, Moradpour D, Podlaha O, Suri V, Gaggar A, Subramanian M, Correia B, Gfeller D, Urban S, Fellay J. Joint host-pathogen genomic analysis identifies hepatitis B virus mutations associated with human NTCP and HLA class I variation. Am J Hum Genet 2024;111(6):1018-1034
  447. Yadav R, Sharma A, Das B, Majumder C, Das A, Sen S, Kundu S. Air and Water Stable Bicyclic (Alkyl)(Amino)Carbene Stabilized Phosphenium Cation: Reactivity and Selective Fluoride Ion Affinity. Chemistry 2024;30(62):e202401730
  448. Yang Z, Carrio-Cordo P, Baudis M. Copy number variation heterogeneity reveals biological inconsistency in hierarchical cancer classifications. Mol Cytogenet 2024;17(1):26
  449. Yepes-García J, Falquet L. Metagenome quality metrics and taxonomical annotation visualization through the integration of MAGFlow and BIgMAG. F1000Res 2024;13:640
  450. Ying K, Liu H, Tarkhov AE, Sadler MC, Lu AT, Moqri M, Horvath S, Kutalik Z, Shen X, Gladyshev VN. Causality-enriched epigenetic age uncouples damage and adaptation. Nat Aging2024;4(2):231-246
  451. Zaika V, Prakash MK, Cheng CY, Schlander M, Lang BM, Beerenwinkel N, Sonnenberg A, Krupka N, Misselwitz B, Poleszczuk J. Optimal timing of a colonoscopy screening schedule depends on adenoma detection, adenoma risk, adherence to screening and the screening objective: A microsimulation study. PLoS One 2024;19(5):e0304374
  452. Zancolli G, von Reumont BM, Anderluh G, Caliskan F, Chiusano ML, Fröhlich J, Hapeshi E, Hempel BF, Ikonomopoulou MP, Jungo F, Marchot P, de Farias TM, Modica MV, Moran Y, Nalbantsoy A, Procházka J, Tarallo A, Tonello F, Vitorino R, Zammit ML, Antunes A. Web of venom: exploration of big data resources in animal toxin research. Gigascience 2024;13:giae054
  453. Zhao H, Baudis M. labelSeg: segment annotation for tumor copy number alteration profiles. Brief Bioinform 2024;25(2):bbad541
  454. Zhao L, Deng H, Zhang J, Zamboni N, Yang H, Gao Y, Yang Z, Xu D, Zhong H, van Geest G, Bruggmann R, Zhou Q, Schmid RA, Marti TM, Dorn P, Peng RW. Lactate dehydrogenase B noncanonically promotes ferroptosis defense in KRAS-driven lung cancer. Cell Death Differ 2024
  455. Zhao Y, Chen J, Andreatta M, Feng B, Xie YQ, Wenes M, Wang Y, Gao M, Hu X, Romero P, Carmona S, Sun J, Guo Y, Tang L. IL-10-expressing CAR T cells resist dysfunction and mediate durable clearance of solid tumors and metastases. Nat Biotechnol 2024;42(11):1693-1704
  456. Zheng J, Guo N, Huang Y, Guo X, Wagner A. High temperature delays and low temperature accelerates evolution of a new protein phenotype. Nat Commun 2024;15(1):2495
  457. Zila N, Eichhoff OM, Steiner I, Mohr T, Bileck A, Cheng PF, Leitner A, Gillet L, Sajic T, Goetze S, Friedrich B, Bortel P, Strobl J, Reitermaier R, Hogan SA, Martínez Gómez JM, Staeger R, Tuchmann F, Peters S, Stary G, Kuttke M, Elbe-Bürger A, Hoeller C, Kunstfeld R, Weninger W, Wollscheid B, Dummer R, French LE, Gerner C, Aebersold R, Levesque MP, Paulitschke V.Proteomic Profiling of Advanced Melanoma Patients to Predict Therapeutic Response to Anti-PD-1 Therapy. Clin Cancer Res 2024;30(1):159-175
  458. van Baardwijk MN, Heijnen LSEM, Zhao H, Baudis M, Stubbs AP. A systematic benchmark of copy number variation detection tools for high density SNP genotyping arrays. Genomics2024;116(6):110962
  459. van Geest G, Haefliger Y, Zahn-Zabal M, Palagi PM. Using Glittr.org to find, compare and re-use online materials for training and education. PLoS One 2024;19(12):e0308729

Browse other years