We turn life-science data into progress

By unlocking the full value of data, the SIB Swiss Institute of Bioinformatics delivers positive impact for society as the national organization for biomedical and biological data in Switzerland.

ATGACGGATGCCGGAATTGGCATGACGGATGCCGGAATTGGCACATAACAAGTACTGCTCGGTCCTTAAGCTGTATTGCACCATATGACGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ATGACGGATGCCGGAATTGGCATGACGGATGCCGGAATTGGCACATAACAAGTACTGCTCGGTCCTTAAGCTGTATTGCACCATATGACGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG

Latest news

Logo ECCB with an image of Geneva in background
News

Geneva to convene 1,400+ data experts at ECCB for biodiversity, AI and health

Digital twins. DNA large language models. FAIR data at scale. Scientists, clinicians, industry leaders and policy experts from over 60 countries will discuss how these and other data science advances are tackling biodiversity, AI and health...
SIB Profile 2026 cover banner
News

SIB Profile 2026 in videos: our latest impacts on science and society

Our annual activity report highlights contributions across the SIB Network to advance life-science knowledge, support Swiss innovation, and tackle global challenges. This year’s edition includes a special focus on environmental protection...
DATARIUM Vernissage 1
News

Datarium: the data science behind health, environmental and AI advances

Officially launched today in Geneva, Datarium is a free open-air exhibition explaining bioinformatics and its little-known contributions to society through engaging Swiss examples. The exhibition was inaugurated by political, scientific and...
Two individuals in blue work uniforms conducting wastewater surveillance in an outdoor setting.
News

Wastewater surveillance of pathogens: 4 recent advances by SIB scientists

Analysis of genetic material in wastewater samples enables cost-effective monitoring of circulating pathogens and helps ensure epidemic preparedness. SIB Groups led by steering board members of our Centre for Pathogen Bioinformatics support...
News
Geneva to convene 1,400+ data experts at ECCB for biodiversity, AI and health
News
SIB Profile 2026 in videos: our latest impacts on science and society
News
Datarium: the data science behind health, environmental and AI advances
News
Wastewater surveillance of pathogens: 4 recent advances by SIB scientists
See all news

In the spotlight

Datarium's visual

What can data tell us about life?

Our new digital exhibition is online: explore how biological data are transforming health, biodiversity, epidemics and AI—and visit the open-air exhibition in Geneva this August.
Cover of the SIB Profile 2026

Discover the SIB Profile 2026

Empowering environmental action / Enabling next-generation cancer care

Delivering positive impact for society

Human and planetary health enabled by data science
Simone de Montmollin

SIB has established itself as the Swiss reference for biological and biomedical data science.

Simone de Montmollin

Swiss National Councillor, President of the Science, Education and Culture Committee SECC

Picture of Jérôme Wojcik

SIB plays a vital role in the Swiss innovation ecosystem by maximizing investments.

Jérôme Wojcik

Industrial Data Scientist & Entrepreneur

Picture of Anita Rauch

Being able to rely on a dedicated organization like SIB is a strong asset for our data-driven projects.

Anita Rauch

Director, Institute of Medical Genetics, University of Zurich

The national organization for life-science data

Europe’s largest national bioinformatics community

SIB links in Swiss Map

We are a not-for-profit organization that federates and strengthens Swiss bioinformatics.
 

See more

We comprise ~700 members from 28 institutional partners and ~200 employees.
 

Join SIB

We represent Switzerland in international projects and contribute to the country’s reputation for excellence, quality, and stability.
 

See more

What is bioinformatics ?

Bioinformatics transforms raw biological data into meaningful, reusable knowledge for decision makers, clinicians, scientists, and artificial intelligence.