ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
Cancer Variant Analysis
15 October 2026
15 October 2026
For-profit: 500 CHF
Please note that this 1-day course will be streamed over 2 half-days, in the afternoon of the following dates:
- 29 October 2026
- 03 November 2026
Overview
Cancer is a disease of the genome. Mutations of genes that regulate cell proliferation and cell death result in uncontrolled growth eventually causing symptoms. During cancer progression, mutations build up that not only affect cell growth, but also can suppress the immune system, increase the chance of metastases and promote genome instability leading to additional malignant mutations.
Characterizing the mutations of malignant tissue has been instrumental for the development of the diagnosis, prognosis and treatment of cancer in the last decades. Cancer is a highly heterogeneous disease, and by knowing the type of mutations, we have a better understanding of the nature of tumors, and can apply precision medicine approaches, like targeted drug and immune therapy.
Cancer variants are somatic, which means that they exist in only a part of the cells in the tissue. Even in a sample of a solid tumor, only a part of the cells contains the driver mutations. This makes analysis of cancer variants more challenging than inherited variants, where we assume (almost) all cells have the same genome.
In this course, you will learn the concepts of calling somatic variants from next generation sequencing data, and the basics of performing cancer variant annotation. The practical work will be mainly based on the GATK4 (Mutect2) pipeline and Ensembl's Variant Effect Predictor (VEP).
Audience
This course is designed for PhD students, clinicians, postdoctoral and other researchers in the life sciences from both academia and industry who work with cancer biology and want to get started with performing somatic variant analysis and interpretation of the results.
Learning outcomes
At the end of the course, the participants should be able to:
-
Understand the difference between germline and somatic variants and the implication of computational analysis
-
Perform a somatic variant analysis on a paired sample (tumor – normal) with GATK4
-
Perform a somatic variant annotation with VEP and use the results to filter possible high-impact mutations in the cancer genome
Prerequisites
Knowledge / competencies
Participants should have knowledge in NGS techniques, quality control and alignment to a reference genome, and detection of genomic variants from read alignment to variant calling and annotation.
To get the most out of this course, you should meet the learning outcomes of Introduction to Sequencing Data Analysis and NGS - Genome Variant Analysis courses or have equivalent know-how experience.
Participants should have a basic understanding of working with command line tools on UNIX-based systems. You can test your skills with Unix with the quiz here. If you do not feel comfortable with UNIX commands, please take our UNIX fundamentals e-learning module.
Technical
Participants should have their own computer with any modern browser installed (e.g. chrome, firefox, edge), with an access to http websites (test it here: http://httpforever.com/, and with a stable Internet access. We will use cloud-based AWS infrastructure , which will serve as a remote work environment for all participants. At the end of the course, the remote environment will be deleted. Information on local installation is also provided in the course materials.
Schedule – CE(S)T time zone
The schedule and course material is available on a dedicated GitHub page.
Application
The registration fees for academics are 100 CHF and 500 CHF for for-profit companies.
While participants are registered on a first come, first served basis, exceptions may be made to ensure diversity and equity, which may increase the time before your registration is confirmed.
Applications will close on 15/10/2026 or as soon as the places will be filled up. Cancellation after 15/10/2026 will not be reimbursed. Please note that participation in SIB courses is subject to our general conditions.
You will be informed by email of your registration confirmation. Upon reception of the confirmation email, participants will be asked to confirm attendance by paying the fees within 5 working days.
Venue and Time
Please note that this 1-day course will be streamed over 2 half-days, from 13:00 to 17:00 CET on the following dates:
- 29 October 2026
- 03 November 2026
Precise information will be provided to the registered participants in due time.
Additional information
Coordination: Diana Marek, SIB Training group.
A Certificate of Attendance will be sent provided you were present at the course, whereas a Certificate of Achievement recommending 0.25 ECTS will be sent provided you passed the exam.
You are welcome to register to the SIB courses mailing list to be informed of all future courses and workshops, as well as all important deadlines using the form here.
SIB abides by the ELIXIR Code of Conduct. Participants of SIB courses are also required to abide by the same code.
For more information, please contact training@sib.swiss.