ATGACGGATGCCGGAATTGGCATGACGGATGCCGGAATTGGCACATAACAAGTACTGCTCGGTCCTTAAGCTGTATTGCACCATATGACGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ATGACGGATGCCGGAATTGGCATGACGGATGCCGGAATTGGCACATAACAAGTACTGCTCGGTCCTTAAGCTGTATTGCACCATATGACGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG

A guided tour through neXtProt

23 February 2023
Streamed
Application deadline:
07 February 2023
Cancellation deadline:
07 February 2023
Lydie Lane
SIB resources
Beginner
Academic: 0 CHF
For-profit: 0 CHF
Applications are closed because the course is full with a long waiting list or has just passed. Sign up to receive notification when a new course is scheduled.
CLOSED

No future instance of this course is planned yet

This course will be streamed to registered participants only.

Overview

neXtProt is a platform developed at SIB that helps researchers answer questions relevant to human proteins. It provides a comprehensive set of high quality, fully traceable and standardized annotations on human proteins at the genomic, transcriptomic and proteomic levels and the tools to explore these, manually or programmatically. As the reference database for the HUPO Human Protein Project since 2013, neXtProt has a strong focus on mass spectrometry data and developed specific companion tools for the proteomics community.

In this 4-h course, participants will learn to find and interpret human protein data, save lists of proteins, plan proteomics experiments and predict the impact of variants using the tools provided in the neXtProt platform.

Schedule - CET time zone

  • 14:00-16:00: Lecture Exploring the universe of human proteins using neXtProt (including 2 Q&A sessions)
  • 16:00-18:00: Hands-on exercises

Audience

This course is targeted to any life scientist or bioinformatician who needs to retrieve comprehensive data on human proteins (variants, PTMs, protein-protein interactions, subcellular location, function etc).

Learning objectives

At the end of the course, the participants should be able to:

  • Use the simple search to find a gene, publication, pathway, etc.
  • Interpret neXtProt annotations and trace back their evidence to the original data source
  • Highlight a specific sequence feature in an entry using the feature viewer
  • Create protein lists and compare them
  • Use neXtProt associated tools to design or interpret a proteomics experiment
  • Use the VEP community tool to predict the impact of a variant
  • Execute a SPARQL query example answering a complex biological question

Prerequisites

Knowledge / competencies

Basic knowledge of biology and proteins is required. This course is designed for beginners and does not require any previous knowledge of the neXtProt platform.

Participants of the hands-on session should prepare a few biological questions beforehand to get the most of the course.
The neXtProt advanced search functionalities are based on SPARQL, a semantic query language for databases that is recognized as one of the key technologies of the semantic web and facilitates interoperability with other resources. Those wishing to try out the advanced search are encouraged to look at this guide prior to the course.

Technical

This course will be streamed, you are thus required to have your own computer with an internet connection.

Application

Deadline for registration and cancellation is set to 07/02/2023.

You will be informed by email of your registration confirmation.

Venue and Time

This course will be streamed using Zoom. The course will start at 14:00 CET and end around 18:00 CET.

Precise information will be provided to the participants on due time.

Additional information

Coordination: Monique Zahn, SIB Training group.

You are welcome to register to the SIB courses mailing list to be informed of all future courses and workshops, as well as all important deadlines using the form here.

Please note that participation to SIB courses is subject to our general conditions.

SIB abides by the ELIXIR Code of Conduct. Participants of SIB courses are also required to abide by the same code.

For more information, please contact training@sib.swiss.