ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
Protein Bioinformatics: Sequence-Structure-Function
02 November 2018
For-profit: 900 CHF
No future instance of this course is planned yet
Overview
Sequence-structure-function relationships of proteins are central to a comprehensive understanding of cellular biology. However, many proteins lack direct and detailed information regarding structure, function, and complex formation. This knowledge gap can be overcome through clearly defined relationships between proteins and the integration of existing data.
Participants will be introduced to primarily web-based tools, designed for life scientists without substantial computational training, for integration and inference of protein structure and function data. The lectures and workshops will be led by the SIB developers of these methods, with specific emphasis on translating this training to the participants' own research questions.
Audience
This course is intended for a wide audience covering Master and PhD students, post-docs, and senior researchers in all areas of life science.
Learning objectives
At the end of the course, participants are expected to:
- identify proteins related by sequence and/or structure and integrate functional annotations from public databases
- develop homology models of protein structure, assess their quality, and make inferences regarding function and regulation
- integrate and interpret protein-protein interaction data
- apply these methods to their own proteins of interest
Prerequisites
Knowledge / competencies
This course is designed for beginners and knowledge of UNIX is not necessary.
Technical
Participants should bring a laptop with wireless connectivity and make sure they have the permission to install software if necessary.
Application
The registration fees for academics are 180 CHF and 900 CHF for for-profit companies. This includes course content material and coffee breaks.
Deadline for registration and free-of-charge cancellation is set is set to 2 November 2018. Cancellation after this date will not be reimbursed. Please note that participation to SIB courses is subject to our general conditions.
You will be informed by email of your registration confirmation.
Venue and Schedule
The course will take place at University of Basel, Kollegienhaus, Seminarraum 103, will start at 9:00 and end around 17:00.
Wednesday 14 November
Morning:
- UniProtKB: manual and automated protein sequence annotation pipelines (Elisabeth Gasteiger, Marie-Claude Blatter)
Afternoon:
- PROSITE, HAMAP, InterPro and automated annotation (Christian Sigrist, Ivo Pedruzzi)
Thursday 15 November
Morning:
- GO, resources standardization (Pascale Gaudet)
Afternoon:
- STRING (Christian von Mering)
Friday 16 November
Morning:
- NextProt (Amos Bairoch, Lydie Lane)
Afternoon:
- SWISS-MODEL (Gabriel Studer, Gerardo Tauriello)
Additional information
Coordination: Diana Marek
We will recommend 0.75 ECTS credits for this course (given a passed exam at the end of the course).
You are welcome to register to the SIB courses mailing list to be informed of all future courses and workshops, as well as all important deadlines using the form here.
For more information, please contact training@sib.swiss.