We turn life science data into progress

By unlocking the full value of data, the SIB Swiss Institute of Bioinformatics delivers positive impact for society as the national organization for biomedical and biological data in Switzerland.

ATGACGGATGCCGGAATTGGCATGACGGATGCCGGAATTGGCACATAACAAGTACTGCTCGGTCCTTAAGCTGTATTGCACCATATGACGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ATGACGGATGCCGGAATTGGCATGACGGATGCCGGAATTGGCACATAACAAGTACTGCTCGGTCCTTAAGCTGTATTGCACCATATGACGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG

Latest news

Sankey diagram showing connections between different categories of information on extracted plant chemicals, such as species, plant part and analysis method, which enables insights into previously disconnected data.
News

Expanding our societal reach in 2025 through new projects and grants

As the year draws to a close, we highlight examples of projects and competitive funding secured in 2025 that expand SIB’s impact – from personalized health and biodiversity to trustworthy AI and Swiss competitiveness. Thank you to our teams...
SENPro logo
News

Connecting Swiss infrastructure to the European Open Science Cloud (EOSC)

By preparing Switzerland for European and other international data-sharing initiatives, the SENPro initiative will enhance open science, accelerate collaboration and innovation, and strengthen national digital sovereignty. A prototype Swiss...
Portrait of Amos Bairoch
News

Amos Bairoch, Swiss pioneer of bioinformatics, passes away

We are deeply saddened to announce the passing of our co-founder and Group Leader Amos Bairoch. Emeritus professor at the University of Geneva, he shaped the development of bioinformatics over more than three decades and played a central...
Portait of SIB Executive Director, Christophe Dessimoz
Opinion

Reliable data for better care

Every medical revolution has been driven by a technological breakthrough: chemical synthesis paved the way for modern medicines, genetics for the first gene therapies. The next frontier will be determined by artificial intelligence.
News
Expanding our societal reach in 2025 through new projects and grants
News
Connecting Swiss infrastructure to the European Open Science Cloud (EOSC)
News
Amos Bairoch, Swiss pioneer of bioinformatics, passes away
Opinion
Reliable data for better care
See all news

In the spotlight

Logo of ECCB 2026

Shape the ECCB 2026 programme

Submit a tutorial or a workshop for the European Conference on Computational Biology (Geneva, 31 August-4 September 2026)
banner for the remarkable outputs

Apply to the SIB Remarkable Outputs 2025

Are you an SIB Member or employee with outstanding work to share? We are accepting applications until 15 January 2026.
What's the point? | The benefits of bioinformatics to science and society

(Re)discover what SIB is all about

We organize vast quantities of life-science data, preserve them in databases, transform them into knowledge, and make them accessible – to enable new discoveries, ethical AI, and informed decisions that advance science and society. That is the point.

Delivering positive impact for society

Human and planetary health enabled by data science
Simone de Montmollin

SIB has established itself as the Swiss reference for biological and biomedical data science.

Simone de Montmollin

Swiss National Councillor, President of the Science, Education and Culture Committee SECC

Picture of Jérôme Wojcik

SIB plays a vital role in the Swiss innovation ecosystem by maximizing investments.

Jérôme Wojcik

Industrial Data Scientist & Entrepreneur

Picture of Anita Rauch

Being able to rely on a dedicated organization like SIB is a strong asset for our data-driven projects.

Anita Rauch

Director, Institute of Medical Genetics, University of Zurich

The national organization for life science data

Europe’s largest national bioinformatics community

SIB links in Swiss Map

We are a not-for-profit organization that federates and strengthens Swiss bioinformatics.
 

See more

We comprise ~700 members from 28 institutional partners and ~200 employees.
 

Join SIB

We represent Switzerland in international projects and contribute to the country’s reputation for excellence, quality, and stability.
 

See more

What is bioinformatics ?

Bioinformatics transforms raw biological data into meaningful, reusable knowledge for decision makers, clinicians, scientists, and artificial intelligence.