ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
AlphaFold for protein structure prediction
09 June 2026
09 June 2026
For-profit: 1000 CHF
No future instance of this course is planned yet
Overview
A protein's 3D structure determines its function, but experimental methods like X-ray crystallography and cryo-EM are slow, expensive, and can't keep pace with the billions of sequences from modern genomics. Recent AI-based tools like AlphaFold2 and AlphaFold3 have changed this, offering predictions that often reach experimental accuracy. Now many life scientists face a different challenge: knowing how to run these methods effectively and when to trust the results.
This two-day, hands-on workshop gives life science researchers practical skills for using modern protein structure prediction tools in their own work. Participants will learn to run AlphaFold2 via the user-friendly ColabFold interface, and AlphaFold3 through AlphaFold Server. Beyond just running predictions, participants will learn how to critically evaluate their results using confidence metrics such as pLDDT, PAE, and ipTM, and how to relate these scores to concrete biological questions.
Audience
This course is designed for PhD students, postdoctoral and other researchers in the life sciences from both academia and industry who wish to apply computational structure prediction to their research but have little to no prior experience in bioinformatics.
Learning outcomes
At the end of the course, the participants are expected to:
- Run AlphaFold2 via ColabFold to predict structures of monomers and protein complexes.
- Run AlphaFold3 via AlphaFold Server to model interactions with DNA, ligands, and other molecules.
- Decide when to use AlphaFold2 or AlphaFold3 for a given biological question and understand the main limitations of each.
- Use metrics such as pLDDT, PAE, pTM and ipTM to assess the quality and reliability of predicted structures.
- Visualize and inspect predicted models in SWISS-MODEL's Structure Assessment tool to support interpretation of their results.
Prerequisites
Knowledge / competencies
This course is designed for beginners.
Technical
You are required to bring your own laptop. More instructions will be communicated to the course participants.
Schedule
Day 1 9:00 -17:00
Foundations & Monomers
- Introduction: Protein structure prediction history, AlphaFold2, relevant concepts (MSAs, Evoformer), limitations
- Practical: Protein monomer prediction using AlphaFold2
- Practical: Using SWISS-MODEL's Structure Assessment tool for prediction visualization and introduction into AlphaFold Database
- Interpreting confidence scores
Day 2 9:00 -17:00
Advanced Topics & Complexes
- Practical: Advanced AlphaFold2 topics - protein complexes and conformational sampling
- Introduction to AlphaFold3
- Practical: Using AlphaFold3
Application
The registration fees for academics are 200 CHF and 1000 CHF for for-profit companies.
While participants are registered on a first come, first served basis, exceptions may be made to ensure diversity and equity, which may increase the time before your registration is confirmed.
You will be informed by email of your registration confirmation. Upon reception of the confirmation email, participants will be asked to confirm attendance by paying the fees within 5 days.
Applications close on 09/06/2026. Deadline for free-of-charge cancellation is set to 09/06/2026. Cancellation after this date will not be reimbursed. Please note that participation in SIB courses is subject to our general conditions.
Venue and Time
This course will take place at the University of Basel. The course will start at 9:00 CET and end around 17:00 CET. Precise information will be provided to the registered participants in due time.
Additional information
Coordination: Valeria Di Cola, SIB Training Group.
We will recommend 0.5 ECTS credits for this course (given a passed exam at the end of the course).
You are welcome to register to the SIB courses mailing list to be informed of all future courses and workshops, as well as all important deadlines using the form here.
Please note that participation in SIB courses is subject to our general conditions.
SIB abides by the ELIXIR Code of Conduct. Participants of SIB courses are also required to abide by the same code.
For more information, please contact training@sib.swiss.