ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
![](/themes/custom/sib/img/trames/tiny/sm/circle-1-green.png)
![](/themes/custom/sib/img/trames/tiny/sm/circle-1-blue.png)
![](/themes/custom/sib/img/trames/tiny/sm/circle-1-red.png)
A guided tour through neXtProt - lecture now on YouTube
21 September 2020
For-profit: 100 CHF
No future instance of this course is planned yet
The video of the lecture can be found in the SIB YouTube channel.
Overview
neXtProt is a platform developed at SIB that helps researchers answer questions relevant to human proteins. It provides a comprehensive set of high quality, fully traceable and standardized annotations on human proteins at the genomic, transcriptomic and proteomic levels and the tools to explore these, manually or programmatically. The neXtProt search functionalities are based on SPARQL, a semantic query language for databases that is recognized as one of the key technologies of the semantic web and facilitates interoperability with other resources. Acting as the reference database for the HUPO Human Protein Project since 2013, neXtProt has a strong focus on mass spectrometry data and developed specific companion tools for the proteomics community.
Schedule - CET time zone
- 13:00-14:00: Lecture - Exploring the universe of human proteins using neXtProt
Audience
This lecture is targeted to any life scientist or bioinformatician who needs to retrieve comprehensive data on human proteins (variants, PTMs, protein-protein interactions, subcellular location, function etc). Proteomicians are particularly welcome.
Learning objectives
At the end of the lecture, the participants should be able to:
- Describe the neXtProt’s data model
- Interpret neXtProt annotations and trace back their evidence
Prerequisites
Knowledge / competencies
This lecture will be streamed, you are thus required to have your own computer with an internet connection.
Technical
This lecture will be streamed. You require a computer with an internet connection.
Application
Attendance is free-of-charge, however registration is mandatory.
You will be informed by email of your registration confirmation.
There is no limit on the number of attendees. All those who will have registered will receive, 1 day before the lecture, by email the information for remotely connecting to the online meeting room.
If you are interested to attend the lecture and practicals, apply here.
Venue and Time
This lecture will be streamed.
It will start at 13:00 and end at 14:00.
Additional information
Coordination: Patricia Palagi
You are welcome to register to the SIB courses mailing list to be informed of all future courses and workshops, as well as all important deadlines using the form here.
Please note that participation in SIB courses is subject to our general conditions.
SIB abides by the ELIXIR Code of Conduct. Participants of SIB courses are also required to abide by the same code.
For more information, please contact training@sib.swiss.