ATGACGGATGCCGGAATTGGCATGACGGATGCCGGAATTGGCACATAACAAGTACTGCTCGGTCCTTAAGCTGTATTGCACCATATGACGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ATGACGGATGCCGGAATTGGCATGACGGATGCCGGAATTGGCACATAACAAGTACTGCTCGGTCCTTAAGCTGTATTGCACCATATGACGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG

A guided tour through neXtProt - lecture and practicals - now on YouTube

22 September 2020
Streamed
Cancellation deadline:
27 August 2020
Lydie Lane and neXtProt colleagues
Academic: 30 CHF
For-profit: 100 CHF
0.125 ECTS credits
Applications are closed because the course is full with a long waiting list or has just passed. Sign up to receive notification when a new course is scheduled.
CLOSED

No future instance of this course is planned yet

The video of the lecture can be found in the SIB YouTube channel.

Overview

neXtProt is a platform developed at SIB that helps researchers answer questions relevant to human proteins. It provides a comprehensive set of high quality, fully traceable and standardized annotations on human proteins at the genomic, transcriptomic and proteomic levels and the tools to explore these, manually or programmatically. The neXtProt search functionalities are based on SPARQL, a semantic query language for databases that is recognized as one of the key technologies of the semantic web and facilitates interoperability with other resources. Acting as the reference database for the HUPO Human Protein Project since 2013, neXtProt has a strong focus on mass spectrometry data and developed specific companion tools for the proteomics community.

Topics that will be covered, and the depth on which they will be covered will depend on the participants needs/wishes:

  • Better understand/interpret neXtProt annotations
  • Using the proteomics tools provided by neXtProt
  • Advanced data querying with SPARQL
  • Using neXtProt’s API

Schedule - CET time zone

  • 13:00-14:00: Lecture - Exploring the universe of human proteins using neXtProt
  • 14:00-17:00: Hands-on, depending on participant’s needs

Audience

This course is targeted to any life scientist or bioinformatician who needs to retrieve comprehensive data on human proteins (variants, PTMs, protein-protein interactions, subcellular location, function etc). Proteomicians are particularly welcome.

Learning objectives

At the end of the course, the participants should be able to:

  • Describe the neXtProt’s data model
  • Interpret neXtProt annotations and trace back their evidence
  • Search for data that corresponds to their biological questions by modifying existing SPARQL queries (programmatic search using neXtProt API)
  • Use neXtProt associated tools to design or interpret a proteomics experiment

Prerequisites

Knowledge / competencies

This course is designed for beginners and does not require any previous knowledge. However, to get the most of the course, the participants of the hands-on session should prepare a few biological questions beforehand.

Technical

This course will be streamed, you are thus required to have your own computer with an internet connection.

Application

The registration fees for academics are 30 CHF and 100 CHF for participants from private companies.

Deadline for registration and free-of-charge cancellation is set to 27/08/2020. Cancellation after this date will not be reimbursed.

You will be informed by email of your registration confirmation.

If you are interested to attend the lecture only, apply for free here.

Venue and Time

This course will be streamed.

The course will start at 13:00 and end around 17:00. Precise information will be provided to the participants on due time.

Additional information

Coordination: Patricia Palagi

We will recommend 0.125 ECTS credits for this course (given a passed exam at the end of the course).

You are welcome to register to the SIB courses mailing list to be informed of all future courses and workshops, as well as all important deadlines using the form here.

Please note that participation to SIB courses is subject to our general conditions.

SIB abides by the ELIXIR Code of Conduct. Participants of SIB courses are also required to abide by the same code.

For more information, please contact training@sib.swiss.