ATGACGGATGCCGGAATTGGCATGACGGATGCCGGAATTGGCACATAACAAGTACTGCTCGGTCCTTAAGCTGTATTGCACCATATGACGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
Exchange, learn and grow: Cultivating a collaborative bioinformatics PhD community

PhD Training Network

The SIB PhD Training Network fosters interactions and exchanges among PhD students and trains them in the most up-to-date bioinformatics methods and tools necessary for their doctoral research.

Participate in network activities and events

Members of the SIB PhD Training Network can take advantage of a range of dedicated activities and participate in national and international bioinformatics events with specific advantages (free or discount registration prices and reimbursement of travel costs):

  • International seasonal schools: The SIB PhD Training Network teams up with other Swiss or international academic institutions to cover a cutting-edge topic of common interest. Usually located in the Swiss mountains, these events promote interaction among members of the network and internationally renowned speakers. These events are also an excellent opportunity to acquire new skills with "learn-by-project" concepts.
  • Annual retreat: Exclusively designed for the members of the PhD Training Network, the retreat represents an opportunity for attendees to present their projects to their peers, acquire soft skills and learn more about careers in the industry.
  • SIB days / [BC]2 conference: Members of the PhD Training Network are invited to attend SIB’s conferences, which foster scientific and social interactions among peers and international experts. An annual Training Network general meeting is usually organized during these events.

Gain teaching experience with SIB

SIB offers members of the PhD Training Network the opportunity to join its community of trainers and develop their teaching skills.

We frequently seek co-trainers and helpers to assist in practical sessions, for instance on courses in programming languages (e.g. R, Python) or data analysis (e.g. Sequencing Data Analysis).

This is a great opportunity to:

  • Work with experts in the field and expand your expertise.
  • Acquire and develop teaching skills.
  • Benefit from free participation in an SIB course of equivalent duration.

Travel and accommodation expenses are covered by SIB.

How to join the PhD Training Network

  • Automatic membership
    PhD students belonging to an SIB-affiliated group are automatically enrolled in the network once their Group Leader or administrative staff informs the SIB administration.
  • On-request membership
    PhD students at a Swiss university, ETHZ, or EPFL who are not supervised by an SIB Member may still join the network under the condition of having a SIB Group Leader as a reference.  In this case, to apply for membership, the PhD student must:
    • Contact an SIB Group Leader to act as a reference.
    • Obtain a letter of recommendation from the Group Leader, confirming the acceptance of the PhD student as an SIB member affiliated with his/her group.
    • Get approval by the PhD supervisor.
    • Fill the admission form.

Network members are expected to actively engage in the program by attending the yearly retreat as well as at least one seasonal school during their PhD.

Network delegates