ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
SARS-CoV-2 : Studying a new virus
22 February 2021
Do you want learn to find, use or interpret basic information about a virus? This asynchronous e-learning course can be completed online, at the desired pace and in the absence of an instructor.
Overview
The first patient infected by the SARS-CoV-2 virus was identified in Wuhan, China in Nov 2019. In December 2019, a new type of virus of the family Coronaviridae called SARS-CoV-2 (formerly 2019-nCoV) was identified as the cause of an outbreak. The sequence of the virus was made public in Jan 2020. What do we know about the SARS-CoV-2 virus responsible for the worldwide COVID-19 pandemic? This e-learning course is based on a series of webinars given during the first half of 2020.
In this e-learning course, you will learn to find, use or interpret information about a virus using the new SARS-CoV-2 virus as an example.
Audience
This e-learning course is designed for PhD students, postdoctoral and other researchers in the life sciences from both academia and industry who would like to use bioinformatics resources to find, use or interpret basic information about a virus.
Competencies
At the end of the e-learning course, participants should be able to:
- Find information about a virus
- Use or interpret information about a virus
Learning outcomes
At the end of the e-learning course, participants are expected to:
- Find information on the SARS-CoV-2 in ViralZone
- Identify information on SARS-CoV-2 glycobiology in GlyConnect
- Evaluate SARS-CoV-2 sequence variability with V-pipe
- Interpret phylogenetic SARS-CoV-2 data to track the evolution of the virus
- Interpret graphs showing the progression of COVID-19
Prerequisites
Knowledge / competencies
Knowledge of the basic molecular biology of viruses is presumed. There are no particular bioinformatics competencies required to take this course.
Technical
None.
Time required
5 hours, 1 hour per module
Instructions
This course has been designed such that modules can be completed in any order. View the course presentation before proceeding to a module.
MODULE 1 - Retrieve and list information on SARS-CoV-2 from ViralZone
MODULE 2 - Find out about SARS-CoV-2 glycobiology using GlyConnect
MODULE 3 - Use V-pipe to evaluate SARS-CoV-2 sequence variability
MODULE 4 - Interpret phylogenetic data to track SARS-CoV-2 evolution
MODULE 5 - Make sense of COVID-19 data
Additional information
You are welcome to register to the SIB courses mailing list to be informed of all future courses and workshops, as well as all important deadlines using the form here.
Please note that participation in SIB courses is subject to our general conditions.
For more information, please contact training@sib.swiss.