ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG



Transcriptomics Analysis: RNA-seq
09 February 2021
Gewinnorientiert: 900 CHF
Nächste(r) Kurs(e):
19 - 21 Jan 2022 |
|
Streamed |
08 - 10 May 2023 |
|
Streamed |
This course is now full with a long waiting list. If you do not want to miss your chance to be part of the next session and remain informed about all training activities at SIB, we highly recommend you to keep an eye on our list of upcoming events and subscribe to our courses mailing list here (if you haven't done so already).
This course will be streamed only for registered participants. Registered participants will receive information from the course organizer in due time.
Overview
This three-day course will provide an overview of the RNA-seq analysis pipeline, as well as the downstream analysis of the resulting data using bioconductor packages in R. The course will cover the following topics:
- The structure of an RNAseq analysis pipeline:
- Raw data quality check;
- RNAseq reads alignment;
- Gene Expression level quantification and normalization by reads counting;
- De novo Transcripts reconstruction and differential splicing.
- Overview of downstream analysis
- Differential Expression analysis with R/Bioconductor packages;
- Class discovery: usage of Principal Component Analysis, Clustering, Heatmaps, Gene Set Enrichment Analysis in RNA-seq analysis.
Next Generation Sequencing (NGS) techniques will not be covered in this course; experimental design as well as the statistical methods will not be detailed in this course.
Audience
Life scientists who are new in the RNA-seq data field but have some R and statistical knowledge.
Prerequisites
Knowledge / competencies
- Participants should already have a basic knowledge of Next Generation Sequencing (NGS) techniques; this course will discuss only the data analysis steps and not the data generation.
- A basic knowledge in statistics is required. Participants should know about p-values, student T-test, multiple testing correction and classification, PCA.
- A basic knowledge of R is also required. Participants should know how to read files, run PCA, do classification, visualise heatmaps using R command lines.
Technical
A Wi-Fi enabled laptop with the latest version of R and Bioconductor installed.
Learning objectives
At the end of the course, participants will be able to:
-
run a RNA-seq pipeline on a small dataset composed of two groups;
-
describe an RNA-seq experimental design;
-
describe pseudo-alignments and alignment software;
-
estimate data quality;
-
normalise counts;
-
know and understand the essential steps of a simple gene expression analysis issued from RNA sequencing;
-
manipulate gene expression matrices and differential expression tables;
-
perform a differential expression analysis based on R/Bioconductor packages (DeSeq2, ...).
Schedule
DAY1
9:00 - 10:30 - Introduction to RNA sequencing
10:30 - 10:45 - Coffee Break
10:45 - 12:30 - RNAseq analysis pipeline, part I
12:30 - 13:30 - Lunch Break
13:30 - 15:00 - RNAseq analysis pipeline, part II
15:00 - 15:15 - Coffee break
15:15 - 17:00 - Practicals
DAY2
9:00 - 10:30 - Differential Expression analysis
10:30 - 10:45 - Coffee Break
10:45 - 12:30 - Differential splicing
12:30 - 13:30 - Lunch Break
13:30 - 15:00 - Practicals
15:00 - 15:15 - Coffee break
15:15 - 17:00 – Practicals
DAY3
9:00 - 10:30 - Differential Expression analysis with DESEQ2
10:30 - 10:45 - Coffee Break
10:45 - 12:30 - Downstream analysis
12:30 - 13:30 - Lunch Break
13:30 - 15:00 - Practicals
15:00 - 15:15 - Coffee break
15:15 - 17:00 - Practicals
Application
This course is now full with a long waiting list. We therefore can't take any other applications.
Registration fees are 180 CHF for academics and 900 CHF for for-profit companies. This includes access to course content material.
You will be informed by email of your registration confirmation, and you will be asked to complete the payment of the registration fees within 5 days.
Deadline for registration and free-of-charge cancellation is set to February 9, 2021. Cancellation after this date will not be reimbursed. Please note that participation to SIB courses is subject to this and other general conditions, available here.
Venue and Time
The course will start at 9:00 CET and end around 17:00 CET using Zoom. Precise information will be provided to the participants before the course.
Additional information
Coordination: Monique Zahn, SIB Training Group.
We will recommend 0.75 ECTS credits for this course (given a passed exam at the end of the course).
You are welcome to register to the SIB courses mailing-list to be informed of all future courses and workshops, as well as all important deadlines using the form here.
SIB abides by the ELIXIR Code of Conduct. Participants of SIB courses are also required to abide by the same code.
For more information, please contact training@sib.swiss.