ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
![](/themes/custom/sib/img/trames/tiny/sm/circle-4-red.png)
![](/themes/custom/sib/img/trames/tiny/sm/circle-1-green.png)
ISMARA and CREMA: automatically inferring gene regulatory networks from gene expression, chromatin accessibility or epigenome data
23 August 2024
23 August 2024
For-profit: 0 CHF
No future instance of this course is planned yet
This course will be streamed to registered participants only.
Overview
Motif Activity Response Analysis (MARA) is a powerful method that automatically infers the most important regulatory interactions acting in a given biological system of interest from either gene expression or chromatin state data. It takes as input either gene expression (i.e. RNA-seq or micro-array), chromatin accessibility (i.e. ATAC-seq or DNase-seq) or epigenome (i.e. ChIP-seq of histone modifications), typically in the form of raw sequencing data files, and then models these data in terms of computationally predicted transcription factor binding sites. In this way, the method infers the key regulators acting in the system of interest, how they change their activity across the input samples, the genomic target regions and genes of each regulator, and so on. MARA analysis has been completely automated and is provided through two online tools: ISMARA and CREMA. Researcher can simply upload their raw data and obtain a comprehensive report on the regulatory network structure within an interactive graphical web interface. In this 1-day course, participants will learn how to use the online tools with their own data, including all the functionalities that the interface provides, how to explore the results that the system produces, how to perform tailored downstream analyses, and how to interpret the various results and predictions.
Audience
This course is aimed at PhD students, post-docs and researchers in life sciences wanting to make computational inferences about gene regulation from gene expression data, chromatin accessibility and epigenetic mark data. The course is targeted to a wide audience ranging from computational biologists and bioinformatics researchers who regularly analyse transcriptome and epigenome data, to experimental researchers interested in inferring key regulatory interactions in their own data.
Learning outcomes
At the end of the course, the participants are expected to:
- Describe the analysis approach used by ISMARA and CREMA.
- Use the ISMARA and CREMA web server.
- Use the interactive web interface to generate tailored analyses.
- Gain a detailed understanding of the meaning and interpretation of the results and predictions provided by these methods.
Prerequisites
Knowledge / competencies
Participants are expected to be familiar with the molecular biology of gene regulation in higher eukaryotes.
No specific bioinformatics skills are necessary.
Technical
This webinar will be streamed; you are thus required to have your own computer with an Internet connection.
To optimally benefit from the course, participants are highly encouraged to upload their own datasets at least a week in advance. This will allow them to explore the results of these analyses on their own data.
Schedule - CET time zone
9:00 – 10:30 Introduction to Motif Activity Response Analysis. Transcription factor binding site predictions, processing of raw high-throughput data, and the MARA model.
10:30 – 11:00 Coffee break
11:00 – 12:30 Using ISMARA and CREMA: supported species and data types, different ways of data uploading. Overview of the basic results provided by the tools: list of key regulators, their activities, lists of target genes, and core networks.
12:30 – 13:30 Lunch break
13:30 – 15:00 Advanced interactive features. Exploring the regulation of specific target genes. Pathways targeting by specific regulators. Averaging across replicate samples. Calculating contrasts between subsets of samples.
15:00 – 15:30 Coffee break
15:30 – 17:00 Hands-on exercises in which users explore results using their own datasets.
Application
Attendance is free-of-charge; however, registration is mandatory.
You will be informed by email of your registration confirmation.
Venue and Time
This course will be streamed.
The course will start at 9:00 CET and end around 17:00 CET.
Precise information will be provided to the participants in due time.
Additional information
Coordination: Monique Zahn, SIB Training group.
You are welcome to register to the SIB courses mailing list to be informed of all future courses and workshops, as well as all important deadlines using the form here.
Please note that participation in SIB courses is subject to our general conditions.
SIB abides by the ELIXIR Code of Conduct. Participants of SIB courses are also required to abide by the same code.
For more information, please contact training@sib.swiss.