ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
Using the Gene Ontology Annotations in UniProt
25 June 2026
25 June 2026
Gewinnorientiert: 0 CHF
Es ist noch keine weitere Auflage dieses Kurses geplant.
Attendance is free of charge; however, registration is mandatory.
Overview
The Gene Ontology (GO) is a framework used to describe gene functions with respect to biological processes, molecular functions, and cellular components. GO is critical in providing a standardized vocabulary that enables consistent gene function annotation and comparison across species.
This 0.5-day course is taught by developers of GO and annotators at UniProt, the world’s leading high-quality, comprehensive and freely accessible resource of protein sequence and functional information. Participants will learn about GO and the different GO annotation processes: the standard GO annotation, the network-based detailed GO-CAM (Gene Ontology Causal Activity Models), and the PAN-GO (Phylogenetic ANnotation using Gene Ontology) approach which integrates evolutionary and network information. Hands-on guidance will be provided on how to navigate GO data through key bioinformatics resources such as UniProt, QuickGO, and AmiGO, focusing on how to access, interpret, and visualize GO annotations. Finally, the course introduces the concept of GO annotation enrichment, explaining how enrichment analysis can help identify overrepresented biological processes or functions in experimental datasets. By the end of the session, participants will have a solid understanding of how GO supports gene function annotation, analysis, and data interpretation in genomics research.
Audience
This course is designed for PhD students, postdoctoral and other researchers in the life sciences from both academia and industry who are interested in protein function, and how these are tied to biological processes and pathways.
Learning outcomes
At the end of the course, participants are expected to:
- State what Gene Ontology is and how it’s used for gene function annotation.
- Distinguish the different GO annotation processes: standard GO annotation, GO-CAM and PAN-GO.
- Locate GO data in UniProt, QuickGO and AmiGO.
- Use the big data analysis technique of Gene Ontology enrichment analysis.
Prerequisites
Knowledge / competencies
This course is designed for beginners. However, knowledge of protein, molecular and cellular biology is required.
We suggest participants watch the video Inside expert biocuration in UniProtKB/Swiss-Prot and complete the free e-learning course Vocabularies for bioinformatics prior to the course.
Technical
Participants are required to have their own computer with an Internet connection. All the suggested resources are available via online tools, and do not require any coding skills.
Application
Attendance is free of charge; however, registration is mandatory. Applications will close on 25/06/2026.
Please note that participation in SIB courses is subject to our general conditions.
Venue and Time
This course will be streamed using Zoom.
It will start at 14:00 CET (08:00 EST) and end around 18:00 CET (12:00 EST).
Precise information will be provided to registered participants in due course.
Additional information
Coordination: Monique Zahn, SIB Training group.
You are welcome to register to the SIB courses mailing list to be informed of all future courses and workshops, as well as all important deadlines using the form here.
Please note that participation in SIB courses is subject to our general conditions.
SIB abides by the ELIXIR Code of Conduct. Participants of SIB courses are also required to abide by the same code.
For more information, please contact training@sib.swiss.