ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
NGS - Genome Variant Analysis
28 May 2026
28 May 2026
Gewinnorientiert: 1000 CHF
Overview
The detection of genetic variation is of major interest in various disciplines spanning from ecology and evolution research to inherited disease discovery and precision oncology. Next generation sequencing (NGS) methods are very powerful for the detection of genomic variants. Thanks to its throughput and cost-efficiency it enables the detection of a large number of variants in a large number of samples. In this two-day course we will cover the steps from read alignment to variant calling and annotation. We will mainly focus on the detection of germline mutations by following the GATK best practices. The training materials for this course are in its dedicated GitHub page.
Audience
This course is designed for PhD students, postdoctoral and other researchers in the life sciences from both academia and industry who are already familiar with general concepts of NGS technologies and want to expand their knowledge and skills on variant analysis.
Learning objectives
At the end of the course participants should be able to:
- Understand important aspects of NGS and read alignment for variant analysis
- Perform a read alignment ready for variant analysis
- Perform variant calling according to GATK best practices
- Perform a variant annotation
Prerequisites
Knowledge / competencies:
Participants should have knowledge in NGS techniques, quality control and alignment to a reference genome. Participants should have a basic understanding of working with command line tools on Unix-based systems. You can test your skills with Unix with the quiz here. If you do not feel comfortable with UNIX commands, please take our Unix fundamentals e-learning module.
Technical:
Participants should have their own computers.
Application
Registration fees are 200 CHF for academics and 1000 CHF for companies.
While participants are registered on a first come, first served basis, exceptions may be made to ensure diversity and equity, which may increase the time before your registration is confirmed.
Applications will close once the places will be filled. Deadline for registration and free-of-charge cancellation is set to 28/05/2026. Cancellation after this date will not be reimbursed. Please note that participation to SIB courses is subject to this and other general conditions, available here.
You will be informed by email of your registration confirmation. Upon reception of the confirmation email, participants will be asked to confirm attendance by paying the fees within 5 days.
Location
This course will take place at the University of Basel.
It will start at 9:00 and end around 17:00.
Precise information will be provided to the participants in due time.
Schedule
The schedule and course materials are in the dedicated GitHub page.
Additional information
Coordination: Valeria Di Cola, SIB Training Group.
We will recommend 0.5 ECTS credits for this course (given a passed exam at the end of the session).
You are welcome to register to the SIB courses mailing list to be informed of all future courses and workshops, as well as all important deadlines using the form here.
Please note that participation in SIB courses is subject to our general conditions.
SIB abides by the ELIXIR Code of Conduct. Participants of SIB courses are also required to abide by the same code.
For more information, please contact training@sib.swiss.