ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
Introduction to Metagenomics Data Analysis of Microbial Communities
27 April 2026
27 April 2026
Gewinnorientiert: 1500 CHF
Overview
This course will cover the metagenomics data analysis workflow from data generation to downstream analysis. Participants will explore the tools to manage, share, analyze and interpret metagenomics data. The content will include issues of data quality control and how to process the data until publication.
Both targeted marker-gene (e.g., 16S) and whole-genome shotgun (WGS) approaches will be covered. Discussions will also explore considerations when selecting the sequencing options (long or short reads), exploring targeted data to OTUs or ASVs, assembling and binning metagenomics data, the analyses that can be carried out, and what downstream analyses options and tools are available.
Audience
This course is designed for PhD students, postdoctoral and other researchers in the life sciences from both academia and industry who are working in the field of metagenomics and are currently in the early stages of data preparation or data analysis.
Learning outcomes
At the end of the course, the participants are expected to:
- Know the concepts of metagenomics
- Understand and compare the two main methods (targeted vs whole genome)
- Perform QC and cleaning of the data
- Comprehend about various databases and pipelines
- Evaluate the results of the pipelines
- Identify downstream analysis options
Prerequisites
Knowledge / competencies
You should meet the learning outcomes of First Steps with R in Life Sciences and either First Steps with UNIX in Life Sciences or the e-learning course UNIX Fundamentals.
Specifically, participants should be familiar with Rstudio, how to install a library, matrix and data frame manipulation, import and export data from text files. In case of doubt, evaluate your R skills with this quiz, before registering.
Technical
You are required to bring your own laptop with the latest R and RStudio versions installed.
Schedule - CET time zone
The course will start at 9:00 and end around 17:00.
Day1am: General introduction to the topic and Unix/R reminder
Day1pm: Sequencing options and QC (short/long reads)
Day2am: 16S analysis with DADA2
Day2pm: 16S downstream analysis
Day3am: WGS assembly/binning with nfcore-mag
Day3pm: WGS downstream analysis
Application
The registration fees for academics are 300 CHF and 1500 CHF for for-profit companies.
While participants are registered on a first come, first served basis, exceptions may be made to ensure diversity and equity, which may increase the time before your registration is confirmed.
You will be informed by email of your registration confirmation. Upon reception of the confirmation email, participants will be asked to confirm attendance by paying the fees within 5 days.
Applications close on 23/04/2025. Deadline for free-of-charge cancellation is set to 23/04/2025. Cancellation after this date will not be reimbursed. Please note that participation in SIB courses is subject to our general conditions.
Venue and Time
This course will take place at the University of Fribourg.
The course will start at 9:00 and end around 17:00. Precise information will be provided to the participants in due time.
Additional information
Coordination: Valeria Di Cola, SIB Training Group.
We will recommend 0.75 ECTS credits for this course (given a passed exam at the end of the course).
You are welcome to register to the SIB courses mailing list to be informed of all future courses and workshops, as well as all important deadlines using the form here.
Please note that participation in SIB courses is subject to our general conditions.
SIB abides by the ELIXIR Code of Conduct. Participants of SIB courses are also required to abide by the same code.
For more information, please contact training@sib.swiss.