ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
Single-Cell Transcriptomics with R
08 October 2024
16 October 2024
Gewinnorientiert: 1500 CHF
Nächste(r) Kurs(e):
| 18 - 20 Mar 2025 |
|
Bern |
| 02 - 04 Jul 2025 |
|
Zürich |
| 12 - 14 Nov 2025 |
|
Bellinzona |
| 18 - 20 Mar 2026 |
|
Streamed |
| 16 - 18 Jun 2026 |
|
Zürich |
| 11 - 13 Nov 2026 |
|
Bellinzona |
This course is now full. You can still apply, in which case your application will be put onto the waiting list and you will be recontacted IF and ONLY IF a seat becomes available. Thank you for your understanding.
Overview
Single-cell RNA sequencing (scRNAseq) allows researchers to study gene expression at the single cell level. For example, scRNAseq can help to identify expression patterns that differ between conditions within a cell-type. To generate and analyze scRNAseq data, several methods are available, all with their strengths and weaknesses depending on the researchers’ needs. This 3-day course will cover the main technologies as well as the main aspects to consider while designing a scRNAseq experiment. In addition, it will cover the theoretical background of analysis methods with hands-on practical data analysis sessions applied to droplet-based methods.
Audience
This course is intended for life scientists and bioinformaticians familiar with "Next Generation Sequencing" who want to acquire the necessary skills to analyse scRNA-seq gene expression data.
Learning objectives
At the end of the course, participants will be able to:
- distinguish advantages and pitfalls of scRNAseq
- design their own scRNA-seq experiment
- apply a downstream analysis using R
Prerequisites
Knowledge
- Participants should already have a basic knowledge in Next Generation Sequencing (NGS) techniques, or have already followed the "NGS - Quality control, Alignment, Visualisation".
- Knowledge in RNA sequencing is mandatory.
- Basic knowledge of R is required. Test your R skills with the quiz here, before registering.
Technical
Attendees should have a Wi-Fi enabled computer. An online R and RStudio environment will be provided. However, in case you wish to perform the practical exercises on your own computer, please take a moment to install the following before the course:
- R version > 4.2.
- Latest RStudio version, the free version is perfectly fine.
Program
The program will be communicated in due time. Program of past occurences can be found on GitHub.
Application
This course is now full. You can still apply, in which case your application will be put onto the waiting list and you will be recontacted IF and ONLY IF a seat becomes available. Thank you for your understanding.
The registration fees for academics are 300 CHF and 1500 CHF for for-profit companies. While participants are registered on a first come, first served basis, exceptions may be made to ensure diversity and equity, which may increase the time before your registration is confirmed.
Applications will close once the places will be filled, untll 08/10/2024. Deadline for free-of-charge cancellation is set to 16/10/2024. Cancellation after this date will not be reimbursed. Please note that participation in SIB courses is subject to our general conditions.
You will be informed by email of your registration confirmation. Upon reception of the confirmation email, participants will be asked to confirm attendance by paying the fees within 5 days.
Venue and Time
The course will ONLY take place, in person, at the Bellinzona Institutes of Science (BIOS+) building, Via Francesco Chiesa 5, Bellinzona, Ticino.
It will start at 9:00 CET and end around 17:00 CET every day.
Please note that a social "apero" will be organised on 29 October after the course.
Precise information will be provided to the participants in due time.
Additional information
Coordination: Diana Marek SIB Training group.
We will recommend 0.75 ECTS credits for this course (given a passed exam at the end of the course).
You are welcome to register to the SIB courses mailing list to be informed of all future courses and workshops, as well as all important deadlines using the form here.
Please note that participation in SIB courses is subject to our general conditions.
SIB abides by the ELIXIR Code of Conduct. Participants of SIB courses are also required to abide by the same code.
For more information, please contact training@sib.swiss.