ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ViralZone: Studying viral diversity
03 April 2023
Looking for reliable information on viruses? This asynchronous e-learning course can be completed online, at the desired pace and in the absence of an instructor.
Overview
ViralZone is a SIB Swiss Institute of Bioinformatics web resource for all viral genera and families. It provides molecular biology information on all kind of viruses, and bridges knowledge to virus or sequence databases. For each virus or family page, ViralZone provides easy access to the corresponding UniProtKB/Swiss-Prot and GenBank viral protein entries. It also contains virion and genome images.
In this e-learning course, you will learn what type of information on viruses is found in ViralZone, where it comes from and how it is organized. Several typical examples of uses of ViralZone will provide ideas on how to use the resource for your own research.
Audience
This e-learning course is for PhD students, postdocs, and researchers, from any scientific environment (academia, facilities, companies, etc.) interested in viral data, as well as anyone looking for virion and viral genome images for use in teaching or publications.
Competencies
At the end of the course, participants should be able to:
- Find information about viruses
- Use or interpret information about viruses
Learning outcomes
At the end of the course, the participants are expected to:
- Describe the scope of ViralZone
- List the sources of the information
- Explain how the information is organized
- State uses of the ViralZone resource
Prerequisites
Knowledge / competencies
Knowledge of the basic molecular biology is presumed. No bioinformatics competencies are required.
Technical
None.
Time required
1 hour
Instructions
- Open the module in a browser tab. As the resource is constantly evolving, some of the images may not correspond to the current web site.
- Open a separate browser tab to carry out the exercises and be able to answer the quizzes.
- If you leave a module before the end, your score will be reset to 0.
Additional information
You are welcome to register to the SIB courses mailing list to be informed of all future courses and workshops, as well as all important deadlines using the form here.
Please note that participation in SIB courses is subject to our general conditions.
For more information, please contact training@sib.swiss.