ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
Using ASAP for Single-Cell Analysis
01 November 2023
01 November 2023
Gewinnorientiert: 0 CHF
Nächste(r) Kurs(e):
| 06 Nov 2024 |
|
Streamed |
This course will take place on consecutive Wednesdays, November 8 and 15, 2023, in the afternoon.
Overview
ASAP (Automated Single-cell Analysis Portal) is a web-based, collaborative portal aimed at democratizing single-cell omics data analyses and rendering it more accessible to researchers. ASAP does not require any installation and enables standardized analyses that can be run in minutes by any user without requiring significant computing power. The entire single-cell analysis pipeline is available in ASAP, allowing users to choose from a panel of tools, and guiding them through tutorials.
This 6 h course introduces participants to using ASAP for single-cell analysis, through lectures and hands-on exercises.
Audience
This course is addressed to students, postdocs, and researchers, from any scientific environment (academia, facilities, companies, etc.) interested in analyzing single-cell data.
Learning outcomes
At the end of the course, the participants are expected to:
- run a single-cell RNA-seq analysis pipeline using ASAP
- choose the best tools and parameters for each analysis step
- carry out cell-type annotation and downstream analyses
Prerequisites
Knowledge / competencies
This course is designed for beginners. Basic knowledge of single-cell analysis (equivalent to the SIB courses Single-cell Transcriptomics or NGS - Single-cell RNA-Seq Analysis) is required.
Technical
This webinar will be streamed, you are thus required to have your own computer with an Internet connection.
Schedule - CET time zone
Wednesday November 8, 2023
15:00-18:00 Introduction to single-cell analysis using ASAP (lecture)
Wednesday November 15, 2023
15:00-18:00 Practical exercises
Application
Attendance is free-of-charge; however, registration is mandatory (use the Apply button below).
You will be informed by email of your registration confirmation.
Applications close on 01/11/2023. Deadline for free-of-charge cancellation is set to 01/11/2023. Please note that participation in SIB courses is subject to our general conditions.
Venue and Time
This webinar will be streamed using Zoom. It will start at 15:00 CET and end around 18:00 CET.
All registered participants will receive the information for remotely connecting to the course by email one week before the course.
Additional information
Coordination: Monique Zahn, SIB training group.
You are welcome to register to the SIB courses mailing list to be informed of all future courses and workshops, as well as all important deadlines using the form here.
Please note that participation in SIB courses is subject to our general conditions.
SIB abides by the ELIXIR Code of Conduct. Participants of SIB courses are also required to abide by the same code.
For more information, please contact training@sib.swiss.