ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
Introduction to NGS ATAC-seq data analysis
03 October 2025
01 October 2025
Gewinnorientiert: 1000 CHF
Es ist noch keine weitere Auflage dieses Kurses geplant.
Overview
ATAC-seq (Assay for Transposase-Accessible Chromatin using sequencing) is a powerful and widely used technique for profiling genome-wide chromatin accessibility. Highly accessible regions are typically enriched for active cis-regulatory elements, including promoters, enhancers, and insulators. By quantifying transposase integration sites, ATAC-seq enables the identification of these elements and the analysis of how accessibility patterns change across different biological conditions or perturbations, helping to uncover mechanisms of gene regulation.
This course will provide an introduction into ATAC-seq technology and its main applications to answer epigenetics related questions.
It will also cover main steps and available tools for the bioinformatics analysis of bulk ATAC-seq data, including:
- Recap of the steps involved in processing and aligning the raw reads
- Quality control assessment specific to ATAC-seq
- Peak calling, annotation and visualisation
- Differential accessibility (DA) analysis
- Functional enrichment analysis of DA peaks
Theoretical and practical sessions will be combined to provide broad context on ATAC-seq analysis methods as well as hands on experience using specific tools.
Audience
This course is addressed to life scientists and bioinformaticians familiar with “Next Generation Sequencing” who want to acquire the necessary skills to process and analyse ATAC-seq data.
Learning outcomes
At the end of the course, the participants are expected to:
- Explain the ATAC-seq technology, its read-out and applications
- Run and evaluate quality control measures specific to ATAC-seq technology
- Perform the main steps to process an ATAC-seq dataset (from raw data to differential accessibility analysis)
- List other possible downstream analysis for ATAC-seq
Prerequisites
Knowledge / competencies
This course is designed for beginners and there is no requirement in previous knowledge analysing ATAC-seq or other epigenetics-related sequencing technologies.
Participants must already have a basic knowledge in Next Generation Sequencing (NGS) techniques, R (evaluate your R skills here) and UNIX (self-assess your skills with the e-learning course UNIX Fundamentals, and this quiz).
Technical
Attendees should have a Wi-Fi enabled computer and the Integrative Genomics Viewer (IGV) installed.
An online R and RStudio environment will be provided. In order to access that environment your computer needs to be able to access http websites (not https). You can check this by browsing this website.
However, in case you wish to perform the practical exercises on your own computer, please take a moment to install the following before the course:
- R version > 4.2.
- Latest RStudio version, the free version is perfectly fine.
Application
The registration fees for academics are 200 CHF and 1000 CHF for for-profit companies.
While participants are registered on a first come, first served basis, exceptions may be made to ensure diversity and equity, which may increase the time before your registration is confirmed.
Applications will close on 01/10/2025 or as soon as the places will be filled up. Deadline for free-of-charge cancellation is set to 1/10/2025. Cancellation after this date will not be reimbursed.
You will be informed by email of your registration confirmation. Upon reception of the confirmation email, participants will be asked to confirm attendance by paying the fees within 5 days.
Venue and Time
This course will take place in person only at the University of Bern.
The course will start at 9:00 CET and end around 17:00 CET.
Precise information will be provided to the registered participants in due time.
Additional information
Coordination: Patricia Palagi
We will recommend 0.5 ECTS credits for this course (given a passed exam at the end of the course).
You are welcome to register to the SIB courses mailing list to be informed of all future courses and workshops, as well as all important deadlines using the form here.
Please note that participation in SIB courses is subject to our general conditions.
SIB abides by the ELIXIR Code of Conduct. Participants of SIB courses are also required to abide by the same code.
For more information, please contact training@sib.swiss.