ATGACGGATGCCGGAATTGGCATGACGGATGCCGGAATTGGCACATAACAAGTACTGCTCGGTCCTTAAGCTGTATTGCACCATATGACGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ATGACGGATGCCGGAATTGGCATGACGGATGCCGGAATTGGCACATAACAAGTACTGCTCGGTCCTTAAGCTGTATTGCACCATATGACGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
Gathering to tackle the most pressing challenges in the field

Conferences

Every year, SIB alternates between one of two biennial conferences; The Swiss Bioinformatic Summit - the SIB days which brings together SIB’s lively community to share the latest developments in bioinformatics and the [BC]2 Basel Computational Biology Conference, Switzerland's leading event in the domain gathering experts in academia, industry, and healthcare from around the world. In addition to these flagship conferences, SIB also supports and participates in scientific events to promote SIB Resources and discoveries. Find below the list of upcoming events where you can find us:

Les Mystères de l’UNIL

22–24 May 2025
Lausanne, Switzerland
les mysteres de l'UNIL
Du 22 au 25 mai, les chercheuses et chercheurs de l’UNIL vous accueillent pour explorer les coulisses de la recherche et questionner les intelligences sous toutes leurs formes. Ateliers pédagogiques...

Annual Meeting - Pathogen Bioinformatics Focus Group

2 June 2025
Basel, Switzerland
Illustration depicting interconnected ropes with DNA helix, microbial life, animals, humans, and data charts symbolizing the intertwined relationship between ecosystems, humanity, and technology
The Annual Meeting 2025 of the SIB Focus Group of the Centre for Pathogen Bioinformatics is taking place on 2 June 2025, Basel (exact location to be announced). Please find the preliminary agenda...

5th Clinic Meets Data Science Symposium

28 August 2025
Basel, Switzerland
a dna illustration a symposium on clinics meet data science
The symposium will showcase current developments in clinical data science, highlight state-of-the-art and future applications and tools and discuss possibilities and opportunities that data science...

[BC]2 Basel Computational Biology Conference

8–10 September 2025
Basel, Switzerland
Logo BC2
The 2025 edition of the [BC]2 Basel Computational Biology Conference, themed "Bioinformatics meets AI: shaping the future of data-driven biology," will take place 8-10 September 2025 in Basel...

Computational Biology Symposium

18–19 September 2025
Lausanne, Switzerland
Banner of the computational biology symposium
Computational biology is everywhere. As biology has developed into a vast field over the last century, available data size increased both in terms of the analyzed samples and assessed biological...

DataSHIELD Conference 2025

23–26 September 2025
Lausanne, Switzerland
DataSHIELD Conference banner
📢 Save the Date! SIB will be hosting the 2025 DataSHIELD Conference which will be held in Lausanne, Switzerland, from 23–26 September 2025. The programme includes beginner and advanced training...

ECCB 2026

31 August – 4 September 2026
Geneva, Switzerland
ECCB logo with text and dates
SIB will host the 25th European Conference on Computational Biology (ECCB) in Geneva, Switzerland, from 31 August to 4 September 2026. Save the date, and subscribe to our newsletter for updates as we...