ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
Introduction to bulk RNA-Seq: From Quality Control to Pathway Analysis
28 September 2020
A but lucratif : 600 CHF
Prochaine(s) formation(s) :
| 02 - 03 Sep 2021 |
|
Streamed |
| 01 - 02 Sep 2022 |
|
Basel |
| 19 - 20 Sep 2023 |
|
Basel |
| 19 - 20 Sep 2024 |
|
Zürich |
| 25 - 26 Sep 2025 |
|
Basel |
| 08 - 09 Oct 2026 |
|
Basel |
This course is over-subscribed with a very long waiting list. We are not accepting applications any more. If you do not want to miss your chance to be part of the next session and remain informed about all training activities at SIB, we highly recommend you to keep an eye on our list of upcoming events and subscribe to our courses mailing list, if not yet done. Thank you for your understanding.
Overview
This two-day course will present the theory and bioinformatics tools required to analyze RNA-seq gene expression data, The course will present the theory and bioinformatics tools required to analyse RNA-seq gene expression data, from the raw data until the biological interpretation. The following topics will be discussed:
- Quality control
- Mapping to genomes & transcriptomes
- Read counting, gene & exons differential expression analysis
- GO enrichment and pathway analysis
Audience
This course is intended for life scientists or bioinformaticians familiar with "Next Generation Sequencing" who wish to acquire the necessary skills to analyse RNA-seq gene expression data.
Learning objectives
At the end of the course attendees will be able to:
- Describe advantages and pitfalls of RNA sequencing
- Design their own experiment
- Perform the downstream analysis using command line software (QC, mapping, counting, differential expression analysis, pathway analysis, etc)
- Critically assess the quality of their results at each step of the downstream analysis
Prerequisites
Knowledge / competencies: Participants should already have a basic knowledge in Next Generation Sequencing (NGS) techniques or already followed the Introduction to NGS course. A basic knowledge of the R statistical software and completion of an introductory course on UNIX (eg UNIX fundamentals) or equivalent knowledge is also required.
Location & Time
This course will be streamed.
It will start at 9:00 and end around 17:00. Precise information will be provided to the participants on due time.Application
This course is over-subscribed with a very long waiting list. We are not accepting applications any more.
The registration fees for academics are 120 CHF and 600 CHF for participants from industry.
Please note that participation to SIB courses is subject to this and other general conditions, available here.
You will be informed by email of your registration confirmation. Upon reception of the confirmation email, participants will be asked to confirm attendance by paying the fees within 5 days.
Additional information
Coordination: Patricia Palagi
We will recommend 0.5 ECTS credits for this course (given a passed exam at the end of the course).
You are welcome to register to the SIB courses mailing list to be informed of all future courses and workshops, as well as all important deadlines using the form here.
Please note that participation in SIB courses is subject to our general conditions.
SIB abides by the ELIXIR Code of Conduct. Participants of SIB courses are also required to abide by the same code.
For more information, please contact training@sib.swiss.