ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
Biology-informed Integration and Visualisation of Multiomics Data
09 September 2026
09 September 2026
A but lucratif : 1500 CHF
Overview
Integrating multiple omics datasets allows researchers to gain a holistic view of biological systems. For example, combining ATAC-seq, RNA-seq, ChIP-seq, and bisulphite-seq can reveal the interplay between chromatin accessibility, gene expression, histone modifications, and DNA methylation.
This 3-day course focuses on the practical application of R to integrate and visualise such multiomics data. Participants will learn to import and combine pre-processed datasets, create overlap matrices to identify regions of co-occurrence, perform functional analysis of results, and master visualisation techniques to communicate complex findings effectively. Throughout, the emphasis is on why each step matters and what biological questions it answers. The course emphasizes hands-on exercises and a project-based approach, enabling participants to directly apply these skills to their own research questions. Participants will work on group projects with published multiomics research data.
Please note: this course starts from pre-processed data (e.g. count matrices and peak calls). It does not cover data pre-processing hands-on, that is, the steps from raw reads to counts/peaks (quality control, alignment, and peak calling).
Audience
This course is designed for PhD students, postdoctoral and other researchers in the life sciences from both academia and industry who wish to integrate, analyse, interpret, and visualise high throughput multiomics data using R.
Learning outcomes
At the end of the course, the participants are expected to:
-
Explain the conceptual basis and necessary data structures for integrating ATAC-seq, RNA-seq, ChIP-seq, and bisulphite-seq.
-
Execute the full pipeline to import, normalize, and integrate pre-processed multiomics data using
Rand Bioconductor packages. -
Differentiate and compare the results obtained from functional analysis methods to identify key regulated regions.
-
Design and develop advanced visualisations, for example enriched heatmaps, to effectively communicate the complex findings of multiomics data integration.
-
Lead the analysis and biological interpretation of a multiomics dataset, functioning as a culminating, challenging application of the entire workflow.
Prerequisites
Knowledge / competencies
This course is designed for beginners in multiomics data integration, but it assumes familiarity with the underlying molecular biology and a working level of R.
This course is part of the SIB Omics Data Analysis learning path. To get the most out of this course, you should meet the learning outcomes of First Steps with R in Life Sciences.
Technical
Biology
While this course is designed for beginners in multiomics data integration, knowledge of fundamental biological concepts related to gene expression (RNA-seq), chromatin accessibility (ATAC-seq), histone modifications (ChIP-seq), and DNA methylation is highly recommended. Participants are encouraged to refresh these concepts beforehand; preparatory reading materials can be provided to registered attendees upon request.
R programming
Basic to intermediate R skills are required, as participants will be challenged with coding and interpretation exercises. You should be able to confidently handle data manipulation and basic functions in R. Test your R skills here before registering.
Technical
Attendees should have a Wi-Fi enabled computer. An online R and RStudio-server environment will be provided.
In case you wish to perform the practical exercises on your own computer, please make sure that your laptop contain over 16 GB of RAM, and please take a moment to install the following before the course:
-
Rversion> 4.6. -
Latest RStudio version, the free version is perfectly fine.
-
Specific packages to be installed information will be provided to registered participants.
Application
The registration fees for academics are CHF 300 and CHF 1500 for for-profit companies. While participants are registered on a first come, first served basis, exceptions may be made to ensure diversity and equity, which may increase the time before your registration is confirmed.
You will be informed by email of your registration confirmation. Upon reception of the confirmation email, participants will be asked to confirm attendance by paying the fees within 5 days.
Applications close on 09/09/2026 or as soon as the places will be filled up. Deadline for free-of-charge cancellation is set to 09/09/2026. Cancellation after this date will not be reimbursed. Please note that participation in SIB courses is subject to our general conditions.
Venue and Time
This course will take place in Bern.
It will start at 9:15 and end around 17:15 every day.
Precise information will be provided to the participants in due time.
Additional information
Coordination: Valeria Di Cola, SIB Training Group.
A Certificate of Attendance will be sent provided you were present at the course, whereas a Certificate of Achievement recommending 0.75 ECTS will be sent provided you passed the exam.
You are welcome to register to the SIB courses mailing list to be informed of all future courses and workshops, as well as all important deadlines using the form here.
Please note that participation in SIB courses is subject to our general conditions.
SIB abides by the ELIXIR Code of Conduct. Participants of SIB courses are also required to abide by the same code.
For more information, please contact training@sib.swiss.