ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
Introduction to Sequencing Data Analysis
07 October 2026
07 October 2026
A scopo di lucro: 1500 CHF
Overview
High-throughput sequencing (HTS) technology has revolutionized the field of biology, including genomics, epigenomics, transcriptomics, and metagenomics. HTS allows numerous DNA molecules to be sequenced simultaneously, rather than one at a time, allowing for unprecedented speed and scale. By generating vast amounts of genetic data rapidly and cost-effectively, HTS allows for the generation of large, comprehensive datasets, providing deeper biological insights.
In this 3-day course, we will introduce the most widely used HTS technologies. Using different datasets, we will practice quality control, alignment of reads to a reference genome and visualize the output.
Audience
This course is designed for PhD students, postdoctoral and other researchers in the life sciences from both academia and industry who are already dealing with HTS data and would like to be able to start analysing them.
Learning outcomes
At the end of the course participants should be able to:
- Distinguish advantages and limitations of HTS technologies, including their applications in omics
- Select appropriate HTS technologies based on experimental design needs
- Apply quality control (QC) measures to HTS datasets to ensure data integrity and reliability for downstream analysis
- Describe the concept and purpose of sequence alignment and differentiate between global and local alignment strategies
- Perform read alignment to a reference genome using appropriate tools
- Analyze alignment outputs to assess accuracy and identify potential issues
- Generate visualizations of HTS data using tools such as IGV
- Evaluate visualized outputs to interpret biological insights and validate results
Prerequisites
Knowledge / competencies
This course is part of the Omics Data Analysis learning path. To get the most out of this course, you should meet the learning outcomes of First Steps with UNIX in Life Sciences or the e-learning course UNIX Fundamentals. Upon completion of this course, you may wish to attend the Single-Cell Transcriptomics with R and Introduction to Bulk RNA-Seq: From Quality Control to Pathway Analysiscourses.
In case of doubt, evaluate your Unix skills with this quiz.
Technical
You will need access to a computer. Software requirements will be communicated before the course.
Application
Registration fees for academics are 300 CHF and 1500 CHF for for-profit companies.
While participants are registered on a first come, first served basis, exceptions may be made to ensure diversity and equity, which may increase the time before your registration is confirmed.
Applications will close on 07/10/2026 or as soon as the places will be filled up. Cancellation after 07/10/2026 will not be reimbursed. Cancellation after this date will not be reimbursed. Please note that participation in SIB courses is subject to our general conditions.
You will be informed by email of your registration confirmation. Upon reception of the confirmation email, participants will be asked to confirm attendance by paying the fees within 5 working days.
Venue and Time
The course will be streamed.
The course will start at 9:00 CET and end around 17:00 CET.
Precise information will be provided to the registered participants in due time.
Additional information
Coordination: Grégoire Rossier, SIB Training group.
A Certificate of Attendance will be sent provided you were present at the course, whereas a Certificate of Achievement recommending [X] ECTS will be sent provided you passed the exam.
You are welcome to register to the SIB courses mailing list to be informed of all future courses and workshops, as well as all important deadlines using the form here.
SIB abides by the ELIXIR Code of Conduct. Participants of SIB courses are also required to abide by the same code.
For more information, please contact training@sib.swiss.