ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
Long-read Sequence Analysis
12 February 2026
12 February 2026
A scopo di lucro: 1000 CHF
Overview
For the last few years, research in DNA and RNA has been dominated by short-read sequencing. Although this has revolutionized the way we answer biological questions, it has its limitations. One important limitation is read length. The invention of high-throughput long-read sequencing has enabled us to solve questions on genome assembly, haplotyping, structural variation and alternative splicing. In this course, the participant will get acquainted with the major long-read sequencing technologies (PacBio SMRT and Oxford Nanopore Technology), and get experience with hands-on work involving long-read data. The training materials for this course are in its dedicated GitHub page. The course includes a guest lecture from Dr. Alban Ramette and Dr. Pamela Nicholson.
Audience
This course is designed for PhD students, postdoctoral and other researchers in the life sciences from both academia and industry who are working with or interested in working with long-read data.
Learning outcomes
At the end of the course, the participants should be able to:
- Understand the basics behind PacBio SMRT sequencing and Oxford Nanopore Technology sequencing
- Use the command line to perform quality control and read alignment of long-read sequencing data
- Perform differential isoform expression analysis or a repeat expansion analysis based on long-read sequencing data
Prerequisites
Knowledge / competencies
This course is part of the Omics Data Analysis learning path. To get the most out of this course, you should meet the learning outcomes of UNIX Fundamentals.
In case of doubt, evaluate your UNIX skills here.
Technical
You are required to bring your own laptop. Software installation instructions will be communicated before the course.
Schedule – CE(S)T time zone
See Course schedule
Application
The registration fees for academics are 200 CHF and 1000 CHF for for-profit companies.
While participants are registered on a first come, first served basis, exceptions may be made to ensure diversity and equity, which may increase the time before your registration is confirmed.
Applications will close on 12.02.2026 or as soon as the places will be filled up. Cancellation after 12.02.2026 will not be reimbursed. Please note that participation in SIB courses is subject to our general conditions.
You will be informed by email of your registration confirmation. Upon reception of the confirmation email, participants will be asked to confirm attendance by paying the fees within 5 working days.
Venue and Time
This course will take place at the University of Bern.
It will start at 9:15 CET and end around 17:15 CET.
Precise information will be provided to the registered participants in due time.
Additional information
Coordination: Valeria Di Cola, SIB Training group.
A Certificate of Attendance will be sent provided you were present at the course, whereas a Certificate of Achievement recommending 0.5 ECTS will be sent provided you passed the exam.
You are welcome to register to the SIB courses mailing list to be informed of all future courses and workshops, as well as all important deadlines using the form here.
SIB abides by the ELIXIR Code of Conduct. Participants of SIB courses are also required to abide by the same code.
For more information, please contact training@sib.swiss.