ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
Single-Cell Transcriptomics with R
14 February 2022
14 February 2022
A scopo di lucro: 900 CHF
Prossimi corsi:
| 04 - 06 Jul 2022 |
|
Bern |
| 14 - 16 Nov 2022 |
|
Bern |
| 06 - 08 Mar 2023 |
|
Streamed |
| 03 - 05 Jul 2023 |
|
Bern |
| 13 - 15 Nov 2023 |
|
Bern |
| 18 - 20 Mar 2024 |
|
Bern |
| 29 - 31 Oct 2024 |
|
Bellinzona |
| 18 - 20 Mar 2025 |
|
Bern |
| 02 - 04 Jul 2025 |
|
Zürich |
| 12 - 14 Nov 2025 |
|
Bellinzona |
| 18 - 20 Mar 2026 |
|
Streamed |
| 16 - 18 Jun 2026 |
|
Zürich |
| 11 - 13 Nov 2026 |
|
Bellinzona |
The course is now full with a long waiting list. If you do not want to miss your chance to be part of the next session and remain informed about all training activities at SIB, we highly recommend you to keep an eye on our list of upcoming events (https://www.sib.swiss/training/upcoming-training-courses) and subscribe to our courses mailing list here (if not yet done): https://lists.sib.swiss/mailman/listinfo/courses. Thank you for your understanding.
Overview
In contrast to the Bulk RNA sequencing used to quantify the abundance of gene and transcript expression at a whole population level, single-cell RNA sequencing (scRNAseq) allows researchers to study gene expression profile at a single cell resolution while enabling the discovery of tissue specific subpopulations and markers. For example, contrasting different sample conditions i.e. disease vs. normal using scRNAseq can help identify sub-cellular differential behaviours and thus target specific gene markers. This 3-day course will cover the main technologies as well main aspects to consider while designing a scRNAseq experiment including a hands-on practical data analysis session applied to droplet-based methods. The training materials for this course are in its dedicated GitHub page.
Audience
This course is intended for life scientists and bioinformaticians familiar with "Next Generation Sequencing" who want to acquire the necessary skills to analyse scRNA-seq gene expression data.
Learning objectives
At the end of the course, participants will be able to:
- distinguish advantages and pitfalls of scRNAseq
- design their own scRNA-seq experiment
- apply a downstream analysis using R
Knowledge / competencies prerequired (Mandatory)
Participants should already have a basic knowledge in Next Generation Sequencing (NGS) techniques, or have already followed the "NGS - Quality control, Alignment, Visualisation". Knowledge in RNA sequencing is a plus. A basic knowledge of the R statistical software is required. Test your R skills with the quiz here, before registering.
Technical requirements
Please check the required installation detailed here, before the start of the course.
Program
The program of this course can be found in its dedicated GitHub page.
Application
The registration fees for academics are 180 CHF and 900 CHF for for-profit companies. While participants are registered on a first come, first served basis, exceptions may be made to ensure diversity and equity, which may increase the time before your registration is confirmed.
You will be informed by email of your registration confirmation. Upon reception of the confirmation email, participants will be asked to confirm attendance by paying the fees within 5 days.
Applications will close once the places are filled. Deadline for registration and free-of-charge cancellation is set to 14/02/2022. Cancellation after this date will not be reimbursed. Please note that participation in SIB courses is subject to our general conditions.
Venue and Time
This course will be streamed.
It will start at 9:00 and end around 17:00.
Precise information will be provided to the participants in due time.
Additional information
Coordination: Patricia Palagi
We will recommend 0.75 ECTS credits for this course (given a passed exam at the end of the course).
You are welcome to register to the SIB courses mailing list to be informed of all future courses and workshops, as well as all important deadlines using the form here.
Please note that participation in SIB courses is subject to our general conditions.
SIB abides by the ELIXIR Code of Conduct. Participants of SIB courses are also required to abide by the same code.
For more information, please contact training@sib.swiss.