ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
Nextflow in Action: Build Smarter, Faster, Reproducible Pipelines
04 November 2025
04 November 2026
A but lucratif : 500 CHF
Aucune instance future de ce cours n'est prévue pour l'instant
This course will take place over two half-day sessions, held exclusively in the afternoons.
Overview
The rapid evolution of computational infrastructure to perform bioinformatics analysis and the claim for more efficient and reproducible workflows have opened a door to include new tools that optimize pipeline execution. The workflow orchestrator Nextflow has arisen as a great alternative to meet these needs given its native capabilities such as the possibility to run the software independently and in parallel, the chance to couple it to many other modules or pipelines and its scalability.
This course empowers the participants with hands-on strategies to wrap their pipelines with Nextflow, streamlining the analysis and allowing a plug-and-play modular design. In addition, the participants will learn to take advantage from other Nextflow features such as the possibility of choosing the software management technology or using different executors from local environments until High Performance Clusters.
Audience
This course is designed for PhD students, postdoctoral and other researchers in the life sciences from both academia and industry who aim at automatizing their analyses and/or in the quest to guarantee scalability and reproducibility of their pipelines through a workflow manager.
Learning outcomes
At the end of the course, the participants are expected to:
- Recognize the benefits of wrapping their routine analysis with a workflow orchestrator.
- Develop their own pipelines wrapped with Nextflow.
- Modularize their pipelines to enhance the control execution.
- Run their pipelines in different environments.
Prerequisites
Knowledge / competencies
This course is intend to those who are familiar with UNIX and Bash scripting. Participants who have already followed the SIB courses "First Steps with UNIX in Life Sciences" and "UNIX Fundamentals".
Technical
You are required to bring your own laptop and they will be asked to sign-up/log-in on GitHub to use GitHub Codespaces.
Schedule
Day 1 13:00 -17:00
- Lecture: Workflow managers and Nextflow architecture.
- Hands-on: Hello world pipeline.
- Lecture: Modularization and workflow.
- Hands-on: RNA-seq pipeline.
Day 2 13:00 -17:00
- Lecture: Executors, profiles and software management.
- Hands-on: Metagenomics pipeline.
- Hands-on: wrapping your pipeline.
- Lecture: nf-core.
- Wrapping-up and closing remarks.
Application
The registration fees for academics are 100 CHF and 500 CHF for for-profit companies.
While participants are registered on a first come, first served basis, exceptions may be made to ensure diversity and equity, which may increase the time before your registration is confirmed.
Applications close on 04/11/2026. Deadline for free-of-charge cancellation is set to 04/11/2026. Cancellation after this date will not be reimbursed. Please note that participation in SIB courses is subject to our general conditions.
You will be informed by email of your registration confirmation. Upon reception of the confirmation email, participants will be asked to confirm attendance by paying the fees within 5 days.
Venue and Time
This course will be streamed over two half-day sessions, held exclusively in the afternoons.
The course will start at 13:00 CET and end around 17:00 CET.
Precise information will be provided to the registered participants in due time.
Additional information
Coordination: Valeria Di Cola, SIB Training.
A Certificate of Attendance will be sent provided you were present at the course, whereas a Certificate of Achievement recommending 0.25 ECTS will be sent provided you passed the exam.
You are welcome to register to the SIB courses mailing list to be informed of all future courses and workshops, as well as all important deadlines using the form here.
SIB abides by the ELIXIR Code of Conduct. Participants of SIB courses are also required to abide by the same code.
For more information, please contact training@sib.swiss.