ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
Introduction to Bulk RNA-Seq: From Quality Control to Pathway Analysis
29 September 2026
29 September 2026
A but lucratif : 1000 CHF
Aucune instance future de ce cours n'est prévue pour l'instant
Overview
Bulk RNA sequencing (bulk RNA-seq) is a technique that measures the average gene expression across a population of cells or a tissue sample. It provides a global view of the transcriptome by pooling RNA from many cells, which is then converted to cDNA, sequenced, and analyzed to identify gene expression differences between samples under different conditions. Bulk RNA-seq is used for tasks like comparing gene expression in healthy versus diseased tissues, identifying biomarkers, and analyzing cellular pathways.
This 2-day course will present the theory and bioinformatics tools required to analyze RNA-seq gene expression data. The course will present the theory and bioinformatics tools required to analyse RNA-seq gene expression data, from the raw data until the biological interpretation. The following topics will be discussed:
- Quality control
- Mapping to genomes & transcriptomes
- Read counting, gene & exons differential expression analysis
- GO enrichment and pathway analysis
Audience
This course is designed for PhD students, postdoctoral and other researchers in the life sciences from both academia and industry who are familiar with "Next Generation Sequencing" and who wish to acquire the necessary skills to analyse RNA-seq gene expression data.
Learning outcomes
At the end of the course, the participants are expected to:
- Describe advantages and pitfalls of RNA sequencing
- Design their own experiment
- Perform the downstream analysis using command line software (QC, mapping, counting, differential expression analysis, pathway analysis, etc)
- Critically assess the quality of their results at each step of the downstream analysis
Prerequisites
Knowledge / competencies
Participants must have basic knowledge in Next-Generation Sequencing (NGS) techniques.
This course is part of the Omics Data Analysis learning path. To get the most out of this course, you should meet the learning outcomes of First Steps with R in Life Sciences and UNIX fundamentals.
In case of doubt, evaluate your R skills here and your UNIX skills here.
Technical
You are required to have your own Wi-Fi enabled laptop.
You should also have access to a terminal on your computer:
- macOS / Linux: you can use the default terminal. If you are unfamiliar with scp, you may want to install a graphical client for file transfer, such as fileZilla
- Windows, you should install a terminal which lets you do ssh (for instance mobaXterm).
Application
The registration fees for academics are 200 CHF and 1000 CHF for for-profit companies.
You will be informed by email of your registration confirmation. Upon reception of the confirmation email, participants will be asked to confirm attendance by paying the fees within 5 days. While participants are registered on a first come, first served basis, exceptions may be made to ensure diversity and equity, which may increase the time before your registration is confirmed. Applications will close as soon as the places will be filled up.
Deadline for free-of-charge cancellation is set to 29/09/2026. Cancellation after this date will not be reimbursed. Please note that participation in SIB courses is subject to our general conditions.
Venue and Time
This course will take place at the University of Basel.
The course will start at 9:00 CET and end around 17:00 CET.
Precise information will be provided to the registered participants in due time.
Additional information
Coordination: Monique Zahn, SIB Training group.
At the end of the course, we will provide a Certificate of Attendance or a Certificate of Achievement recommending 0.5 ECTS credits (given a passed exam).
You are welcome to register to the SIB courses mailing list to be informed of all future courses and workshops, as well as all important deadlines using the form here.
Please note that participation in SIB courses is subject to our general conditions.
SIB abides by the ELIXIR Code of Conduct. Participants of SIB courses are also required to abide by the same code.
For more information, please contact training@sib.swiss.