ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ISMARA: A tool to infer genome-wide regulatory interactions
24 November 2022
Do you want to infer key regulators, their targets and interactions from your micro-array, RNA-seq and ChIP-seq data? This asynchronous e-learning course can be completed online, at the desired pace and in the absence of an instructor.
Overview
Motif Activity Response Analysis (MARA) models genome-wide gene expression and chromatin state data in terms of computationally predicted regulatory sites. MARA can thus infer key regulators, their targets, and their interactions from high-throughput data. MARA has been completely automated into an integrated system, ISMARA that allows any researcher to infer gene regulatory interactions from micro-array, RNA-seq and ChIP-seq data. ISMARA is a SIB resource listed in Expasy, the Swiss Bioinformatics Portal.
In this e-learning course, you will learn what ISMARA does, its scope, the format of the data it analyses, its terms of use, as well as how to interpret its output. Several examples of the typical use of ISMARA are presented to provide ideas for how this system could be used in your own research.
Audience
This e-learning course is designed for PhD students, postdoctoral and other researchers in the life sciences from both academia and industry who wish to learn to use the ISMARA tool.
Competencies
At the end of the e-learning course, participants should be able to:
- Describe what ISMARA does
- Use and interpret ISMARA results
Learning outcomes
At the end of the e-learning course, participants are expected to:
- Describe what the ISMARA tool does
- Define the scope and format of the data for ISMARA
- Interpret the results obtained using ISMARA
- Provide examples of what ISMARA can be used for
Prerequisites
Knowledge / competencies
Basic knowledge of genome-wide expression or ChIP-seq data is required for this e-learning course. No particular bioinformatics competencies are required.
Technical
None.
Time required
1 hour
Instructions
- Open the module in a browser tab. As the resource is constantly evolving, some of the images may not correspond to the current web site.
- Open a separate browser tab to carry out the exercises and be able to answer the quizzes.
- If you leave a module before the end, your score will be reset to 0.
Additional information
You are welcome to register to the SIB courses mailing list to be informed of all future courses and workshops, as well as all important deadlines using the form here.
Please note that participation in SIB courses is subject to our general conditions.
For more information, please contact training@sib.swiss.