ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
Introduction to Small RNA-seq Data Analysis with R
28 September 2026
05 October 2026
A scopo di lucro: 1000 CHF
Overview
Small RNA sequencing is a powerful technology that enables researchers to investigate the expression and regulatory roles of short non-coding RNAs, such as microRNAs, siRNAs, tRNAs, and piRNAs, across diverse biological systems. This course provides a practical introduction to the analysis of small RNA sequencing data, combining essential theoretical background with hands-on exercises using primarily the R/Bioconductor ecosystem. Participants will gain an understanding of experimental design, data preprocessing (including adapter trimming and size selection), and downstream analysis workflows such as differential expression. Through lectures and guided practicals, the course aims to equip participants with the skills needed to perform their own small RNA analyses and interpret the results within a meaningful biological context.
Audience
This course is designed for PhD students, postdoctoral and other researchers in the life sciences from both academia and industry who are seeking to understand and analyze small RNAs sequencing data.
Learning outcomes
At the end of the course, participants should be able to:
-
Explain the principles of small RNA sequencing and describe the biological roles and applications of short non-coding RNAs (e.g., miRNAs, siRNAs, tRNAs, piRNAs).
-
Identify common sources of technical bias and recognize limitations in small RNA-seq experiments and analysis workflows.
-
Describe key steps in experimental design and distinguish between different library preparation strategies for small RNA sequencing.
-
Interpret raw sequencing outputs (e.g., FASTQ files) and summarize their structure and relevance for downstream analysis.
-
Apply standard preprocessing methods, including adapter trimming, read filtering, alignment, and quantification of small RNAs.
-
Apply appropriate methods for quality control, normalization, and differential expression analysis in bulk small RNA-seq data.
-
Analyze and interpret differential expression results in a biological context, including the identification of relevant small RNAs.
-
Evaluate analysis results and assess their robustness, reproducibility, and biological significance.
-
Use established tools within the
R/Bioconductor ecosystem to perform end-to-end bulk small RNA-seq data analysis workflows.
Prerequisites
Knowledge
You should meet the learning outcomes of:
In summary, participants must already have a basic knowledge in:
- High-throughput sequencing (HTS) technologies and their general workflows
- Common HTS data formats, including FASTA, FASTQ, SAM/BAM, and GTF/GFF3
- Fundamental concepts of RNA biology, particularly non-coding RNAs (e.g., microRNAs and other small RNAs)
R(evaluate yourRskills here)
Technical
Attendees should have a Wi-Fi enabled computer. An online R and RStudio environment will be provided. However, in case you wish to perform the practical exercises on your own computer, please take a moment to install R (> 4.5) and Rstudio before the course.
Application
The registration fees for academics are CHF 200 and CHF 1000 for for-profit companies.
While participants are registered on a first come, first served basis, exceptions may be made to ensure diversity and equity, which may increase the time before your registration is confirmed.
Applications will close on 28/09/2026 or as soon as the places will be filled up. Cancellation after 05/10/2026 will not be reimbursed. Please note that participation in SIB courses is subject to our general conditions.
You will be informed by email of your registration confirmation. Upon reception of the confirmation email, participants will be asked to confirm attendance by paying the fees within 5 days.
Venue and Time
The course will take place in Zurich.
Sessions will run from 09:00 to approximately 17:00 each day.
Precise information will be provided to the registered participants in due time.
Additional information
Coordination: Patricia Palagi, SIB Training group.
A Certificate of Attendance will be sent provided you were present at the course, whereas a Certificate of Achievement recommending 0.5 ECTS will be sent provided you passed the exam.
You are welcome to register to the SIB courses mailing list to be informed of all future courses and workshops, as well as all important deadlines using the form here.
SIB abides by the ELIXIR Code of Conduct. Participants of SIB courses are also required to abide by the same code.
For more information, please contact training@sib.swiss.