ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
Gene Expression made Useful Easily: Tools and Database of Bgee
26 May 2026
26 May 2026
A scopo di lucro: 0 CHF
Attendance is free of charge; however, registration is mandatory.
Overview
Bgee is a curated database of gene expression in animals, including model species such as human, mouse or drosophila, and others such as livestock, primates, or fishes, covering biodiversity as well as applied research. Single-cell and bulk data are reprocessed, carefully curated, and standardized. They can be retrieved through web and R tools, and programmatic access. Bgee also includes analysis tools leveraging these data, such as TopAnat or Expression Comparison.
This 0.5-day course is taught by the developers of Bgee. In this course, they will present their curated and pre-analysed gene expression data, and explain how to use these data and the related tools.
Audience
This course is designed for PhD students, postdoctoral and other researchers in the life sciences from both academia and industry who need to retrieve curated gene expression, obtain expression-based knowledge on genes of interest, or compare expression between genes and between species.
Learning outcomes
At the end of the course, the participants are expected to:
- Find active genes from bulk or single-cell RNA-Seq.
- Describe information on expression that Bgee can provide in model and non-model species.
- Understand the added value of Bgee data curation and analysis.
- List the Bgee web tools and state their utility to research.
Prerequisites
Participants should have basic knowledge of the expression of genes and the technologies used to detect gene expression.
Technical
You are required to have your own computer with an Internet connection. All the suggested resources are available without you having to install or code anything.
Schedule - CET time zone
| Time | Activity |
|---|---|
| 16:00-16:10 | Welcome |
| 16:10-16:40 | Overview of Bgee |
| 16:40-16:50 | Q&A |
| 16:50-17:45 | Present and absent calls from transcriptome data |
| 17:45-17:55 | Q&A |
| 17:55-18:05 | Break |
| 18:15-18:45 | Data integration in Bgee |
| 18:45-18:55 | Q&A |
| 18:55-19:30 | Bgee tools |
Application
Attendance is free of charge; however, registration is mandatory. Applications will close on 05/05/2026.
You will be informed by email of your registration confirmation.
Please note that participation in SIB courses is subject to our general conditions.
Venue and Time
This course will be streamed using Zoom.
It will start at 16:00 CET and end at 19:30 CET.
Precise information will be provided to registered participants in due course.
Additional information
Coordination: Monique Zahn, SIB Training group.
You are welcome to register to the SIB courses mailing list to be informed of all future courses and workshops, as well as all important deadlines using the form here.
Please note that participation in SIB courses is subject to our general conditions.
SIB abides by the ELIXIR Code of Conduct. Participants of SIB courses are also required to abide by the same code.
For more information, please contact training@sib.swiss.