ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
Introduction to Sequencing Data Analysis
25 March 2026
25 March 2026
A scopo di lucro: 1500 CHF
Prossimi corsi:
| 21 - 23 Oct 2026 |
|
Zürich |
Overview
High-throughput sequencing (HTS) technology has revolutionized the field of biology, including genomics, epigenomics, transcriptomics, and metagenomics. HTS allows numerous DNA molecules to be sequenced simultaneously, rather than one at a time, allowing for unprecedented speed and scale. By generating vast amounts of genetic data rapidly and cost-effectively, HTS allows for the generation of large, comprehensive datasets, providing deeper biological insights.
In this 3-day course, we will introduce the most widely used HTS technologies. Using different datasets, we will practice quality control, alignment of reads to a reference genome and visualize the output.
Audience
This course is designed for PhD students, postdoctoral and other researchers in the life sciences from both academia and industry who are already dealing with HTS data and would like to be able to start analysing them.
Learning outcomes
At the end of the course participants should be able to:
- Distinguish advantages and limitations of HTS technologies, including their applications in omics
- Select appropriate HTS technologies based on experimental design needs
- Apply quality control (QC) measures to HTS datasets to ensure data integrity and reliability for downstream analysis
- Describe the concept and purpose of sequence alignment and differentiate between global and local alignment strategies
- Perform read alignment to a reference genome using appropriate tools
- Analyze alignment outputs to assess accuracy and identify potential issues
- Generate visualizations of HTS data using tools such as IGV
- Evaluate visualized outputs to interpret biological insights and validate results
Prerequisites
Knowledge / competencies
You should meet the learning outcomes of First Steps with UNIX in Life Sciences or the e-learning course UNIX Fundamentals.
In case of doubt, evaluate your Unix skills with this quiz.
Technical
Participants should bring their own computers. Software requirements will be communicated before the course.
Application
Registration fees for academics are 300 CHF and 1500 CHF for for-profit companies.
While participants are registered on a first come, first served basis, exceptions may be made to ensure diversity and equity, which may increase the time before your registration is confirmed.
Applications will close on 25/03/2026 or as soon as the places will be filled up. Deadline for free-of-charge cancellation is set to 25/03/2026. Cancellation after this date will not be reimbursed.
You will be informed by email of your registration confirmation. Upon reception of the confirmation email, participants will be asked to confirm attendance by paying the fees within 5 days.
Venue and Time
The course will be streamed via Zoom.
The course will start at 9:00 and end around 17:00 CEST. A social apero might be organised at the end of the first day (TBC).
Precise information will be provided to the participants on due time.
Additional information
Coordination: Diana Marek, SIB Training group.
We will recommend 0.75 ECTS credits for this course (given a passed exam at the end of the course).
You are welcome to register to the SIB courses mailing list to be informed of all future courses and workshops, as well as all important deadlines using the form here.
Please note that participation in SIB courses is subject to our general conditions.
SIB abides by the ELIXIR Code of Conduct. Participants of SIB courses are also required to abide by the same code.
For more information, please contact training@sib.swiss.