ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG



Using ASAP for Single-Cell Analysis
30 October 2024
30 October 2024
A scopo di lucro: 0 CHF
This course will be streamed to registered participants only.
Overview
ASAP (Automated Single-cell Analysis Portal) is a web-based, collaborative portal aimed at democratizing single-cell omics data analyses and rendering it more accessible to researchers. ASAP does not require any installation and enables standardized analyses that can be run in minutes by any user without requiring significant computing power. The entire single-cell analysis pipeline is available in ASAP, allowing users to choose from a panel of tools, and guiding them through tutorials.
This 1 day course introduces participants to using ASAP for single-cell analysis, through lectures and hands-on exercises.
Audience
This course is addressed to students, postdocs, and researchers, from any scientific environment (academia, facilities, companies, etc.) interested in analyzing single-cell data.
Learning outcomes
At the end of the course, the participants are expected to:
- run a single-cell RNA-seq analysis pipeline using ASAP
- choose the best tools and parameters for each analysis step
- carry out cell-type annotation and downstream analyses
Prerequisites
Knowledge / competencies
Basic knowledge of single-cell analysis equivalent to the SIB course Single-Cell Transcriptomics with R is required.
Technical
This course will be streamed, you are thus required to have your own computer with an Internet connection.
To optimally benefit from the course, participants are highly encouraged to run ASAP on their own data.
Schedule - CET time zone
Wednesday November 6, 2024
9:00 – 10:30 Introduction to single-cell analysis using ASAP (Part 1)
10:30 – 10:45 Coffee break
10:45 – 12:30 Introduction to single-cell analysis using ASAP (Part 2)
12:30 – 13:30 Lunch break
14:00 – 15:30 Practical exercises (Part 1)
15:30 – 15:45 Coffee break
15:45 – 18:00 Practical exercises (Part 2)
Application
Attendance is free-of-charge; however, registration is mandatory.
While participants are registered on a first come, first served basis, exceptions may be made to ensure diversity and equity, which may increase the time before your registration is confirmed.
Applications will close as soon as all places are filled or on 30/10/2024 at the latest. Deadline for free-of-charge cancellation is set to 30/10/2024. Please note that participation in SIB courses is subject to our general conditions.
You will be informed by email of your registration confirmation.
Venue and Time
This webinar will be streamed using Zoom. It will start at 9:00 CET and end around 18:00 CET.
All registered participants will receive the information for remotely connecting to the course by email one week before the course.
Additional information
Coordination: Monique Zahn, SIB training group.
You are welcome to register to the SIB courses mailing list to be informed of all future courses and workshops, as well as all important deadlines using the form here.
Please note that participation in SIB courses is subject to our general conditions.
SIB abides by the ELIXIR Code of Conduct. Participants of SIB courses are also required to abide by the same code.
For more information, please contact training@sib.swiss.