ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG



Enzymes: Extracting Biological Insight Using UniProt
30 May 2024
30 May 2024
A scopo di lucro: 0 CHF
The recording of this webinar is available on YouTube.
Overview
Are you struggling to answer a question about proteins, more specifically, enzymes? Unsure whether the information you need is in UniProt? If so, this webinar is for you.
UniProt is the world’s leading high-quality, comprehensive and freely accessible resource of protein sequence and functional information. Enhanced enzyme annotation in UniProtKB is based on Rhea, a comprehensive expert-curated database of biochemical reactions that uses the ChEBI ontology to describe reaction participants.
Starting with a biological question (I.e., Could you refine my list of enzymes to identify the ones with cysteine at the active and/or allosteric sites?), you will explore the different ways of answering it, using UniProt's advanced query, or SPARQL when the use of UniProt advanced queries is not applicable. Hints on how to extend queries to other biological contexts will also be provided.
This 1-h webinar will introduce the enzyme-related data in UniProt and how to find it.
Audience
This webinar is for beginners interested in protein enzymes.
Learning outcomes
At the end of this webinar, the participants are expected to:
- describe the information on enzymes found in UniProt
- use the advanced search to query UniProt for enzyme information
- recognize when the advanced search cannot be used to answer a question
- understand how a SPARQL query is constructed
- execute a SPARQL query to retrieve enzyme data from UniProt
- know where to find help, documentation and get support
Prerequisites
Knowledge / competencies
Knowledge of biology and enzymes is required for this course.
Technical
This webinar will be streamed; you are thus required to have your own computer with an Internet connection.
Application
Attendance is free-of-charge; however, registration is mandatory (use the Apply button below).
You will be informed by email of your registration confirmation.
Venue and Time
This webinar will be streamed using Zoom. It will start at 15:00 CET (09:00 EST) and end around 16:00 CET (10:00 EST).
All registered participants will receive the information for connecting remotely by email one working day prior to the webinar.
Additional information
Coordination: Monique Zahn, SIB Training group.
You are welcome to register to the SIB courses mailing list to be informed of all future courses and workshops, as well as all important deadlines using the form here.
Please note that participation in SIB courses is subject to our general conditions.
SIB abides by the ELIXIR Code of Conduct. Participants of SIB courses are also required to abide by the same code.
For more information, please contact training@sib.swiss.