ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
ATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAAGTAC
TGCCTCGGTCCTTAAGCTGTATTGCACCATATGACGGATGCCGGAATTGGCACATAACAACGGTCCTTAAGCTGTATTGCACCATATGACG
GATGCCGGAATTGGCACATAACAAGTACTGCCTCGGTCCTTAAGCTGTATTTCGGTCCTTAAGCTGTATTCCTTAACAACGGTCCTTAAGG
BLAST and multiple sequence alignment (MSA) programs
02 December 2013
New to searching for similar protein or nucleotide sequences in biological databases? This asynchronous e-learning course can be completed online, at the desired pace and in the absence of an instructor.
Overview
The rapid identification of pathogens infecting livestock is essential to appropriately respond to the threat. The number and the variety of pathogen sequenced genomes have been growing more dramatically these recent years, because of the new sequencing technologies. This wealth of new data is very useful to the research field through the development of bioinformatics tools and databases that deal with large amount of sequences. Among them, BLAST (Basic Local Alignment Search Tool) and MSA (multiple sequence alignment) programs are very efficient for protein or nucleotide sequence similarity search.
This e-learning course introduces the main biological databases, alignment tool BLAST and multiple sequence alignments (MSA) programs, and interpretation of results.
Audience
Academicians, researchers, and students from all countries working in the field of molecular genetics and epidemiology.
Learning outcomes
At the end of the course, the participants are expected to:
- Build and interpret a multiple sequence alignment
- Understand and interpret BLAST results
Prerequisites
Knowledge / competencies
None.
Technical
None.
Time required
2 hours
Instructions
This e-learning course has been designed to follow the chapters sequentially. Open the link for the chapter in a separate browser tab.
Chapter 2: Building Phylogenetic Trees
Additional information
You are welcome to register to the SIB courses mailing list to be informed of all future courses and workshops, as well as all important deadlines using the form here.
Please note that participation in SIB courses is subject to our general conditions.
For more information, please contact training@sib.swiss.